Growth curve of Bacillus sub­tilis subsp. 168 and ge­nomic DNA iso­la­tion

We are us­ing Bacillus subsp. sub­tilis str. 168 as a chas­sis for our pro­ject. Bacillus sub­tilis 168 cul­ture was grown in LB medium for 80 hours. OD600 was taken every 30 min­utes for the first 8 hours and then every 8 hours for the next 72 hours. A growth curve show­ing ex­po­nen­tial growth phase, lag phase and death phase was ob­tained. We also iso­lated ge­nomic DNA of Bacillus sub­tilis 168 fol­low­ing this pro­to­col

Figure 1. Growth curve of Bacillus sub­tilis 168

Cloning Experiments

Xylanase

Cloning of genes cod­ing for Xylanases:

1: Amplification of genes cod­ing for Xylanases:

Our team am­pli­fied all four Xylanase genes from the ge­nomic DNA of Bacillus sub­tilis-168. We am­pli­fied this us­ing Thermofisher Phusion™ High-Fidelity DNA Polymerase via PCR us­ing Forward and Reverse primers with Following re­stric­tion sites, shown in the table. The primers used for PCR Amplification were:-

Gene Primer Restriction site
xynA (BBa_K4382010) Forward Primer: 5’-ACGCGTCGACATGTTTAAGTTTAAAAAGAATTTC-3’
Reverse Primer : 5’-AAGGAAAAAAGCGGCCGCTTACCACACTGTTACGTTA-3’
SalI

NotI
xynB (BBa_K4382003) Forward primer: 5’ AAGGAAAAAAGCGGC CGC ATGAAGATTACCAATCCC GTACTTAAGGTTC 3’
Reverse Primer:5’ ACCGCTCGAGTTATTT TTCTTTATAACGAAAATATCTAAAGTC GGCCGG 3’
XhoI

NotI
xynC (BBa_K4382004) Forward primer: 5’ACGCGTCGACATGATTCCACGCATAAAAAAAACAATTTGTG3’
Reverse primer :5’AAGGAAAAAAGCGGCCGCTTAACGATTTACAACAAATGTTGTCACGC 3’
XhoI

SalI
xynD (BBa_K4382005) Forward primer: 5’AAGGAAAAAAGCGGCCGCATGAGGAAAAAGTGTAGCG 3’
Reverse primer : 5’CCGCTCGAGCTATCTTTGCGTAAACTGC3’
XhoI

NotI
a)
b)

Figure 2. PCR am­pli­fi­ca­tion of Xylanase genes. a) PCR am­pli­fi­ca­tion of xynB, xyn A, and xynD from the ge­nomic DNA of Bacillus sub­tilis subsp. sub­tilis 168. Arrows in­di­cate the size of the am­pli­cons ob­tained b) PCR am­pli­fi­ca­tion of the gene xynC from the ge­nomic DNA of Bacillus sub­tilis. The PCR prod­uct was run on 1% agarose gel along with 1 kb DNA lad­der (Thermo Scientific)

2: Digestion of gene frag­ments:

To clone these am­pli­fied gene frag­ments, we di­gested them with the fol­low­ing re­stric­tion en­zymes so that we can ob­tain com­pat­i­ble frag­ments for lig­a­tion in the vec­tor. All the re­stric­tion en­zymes are NEB High-Fidelity en­zymes.

Gene Fragment Restriction en­zyme used for di­ges­tion Ligated in fol­low­ing vec­tor Antibiotic used for se­lec­tion
xynA (BBa_K4382010) NotI & SalI pET-28a(+) Kanamycin (50µg\ml)
xynB (BBa_K4382003) NotI & XhoI pCri-18a Ampicillin (100µg\ml)
xynC (BBa_K4382004) NotI & SalI pET-28a(+) Kanamycin (50µg\ml)
xynD(BBa_K4382005) NotI & XhoI pCri-18a Ampicillin (100µg\ml)
a)
b)

Figure 3. Gel im­age of the am­pli­fied frag­ments of xynA, xynB, xynC, and xynD di­gested with re­stric­tion en­zymes a) Double di­ges­tion of xynA by NotI and SalI, xynB by NotI and XhoI , and xynD by NotI and XhoI. The di­gested prod­uct was run on the 1% agarose gel along with 1 kb DNA lad­der and bands ob­tained are marked with ar­rows in the im­age above.

3. Ligation and Transformation:

Following this, dou­ble di­gested in­sert was lig­ated with a com­pat­i­ble vec­tor di­gested with the same re­stric­tion en­zymes as men­tioned in Table 2 us­ing T4 DNA lig­ase en­zyme by NEB. After the lig­a­tion re­ac­tion, each of the lig­ated mix­tures was trans­formed in 100μl of DH5ɑ com­pe­tent cells and then plated on Agar plates with the ap­pro­pri­ate se­lec­tion marker men­tioned in table 2.

a) _xynA_
b) _xynB_
c) _xynC_
d) _xynD_

Figure 4. Plate show­ing colonies ob­tained af­ter the suc­cess­ful trans­for­ma­tion of the lig­ated prod­uct into Dh5ɑ. a),b),c), and d) rep­re­sent trans­for­mants for the cloned xynA, xynB, xyn C, and xynD genes.

4. Confirmation of Cloned con­struct:

After get­ting colonies we started to screen them by colony PCR. We ran­domly se­lected colonies from the plates and set up a PCR re­ac­tion. Here NEB Taq poly­merase Enzyme was used for the screen­ing by colony PCR.

a)
b)

Figure 5. 1% agarose gel show­ing the bands ob­tained af­ter colony PCR of (a)7 colonies of xynB, and (b)7 colonies of xynC. a) and b) im­ages show the pos­i­tive clone of xynB and xynC re­spec­tively as con­firmed by the pres­ence of the bands of sizes in­di­cated by the ar­rows.

Here, xynB and xynC were con­firmed by colony PCR but xynD was con­firmed by dou­ble di­ges­tion of iso­lated plas­mid from colonies.Due to time re­stric­tions, we could­n’t process xynA by cPCR or dou­ble di­ges­tion. The work is in progress.

5. Final con­fir­ma­tion of con­struct by dou­ble di­ges­tion:

For fi­nal con­fir­ma­tion, we di­gested all the cloned con­struct by fol­low­ing en­zymes:

Construct Restriction en­zyme used Expected Plasmid Size (Kb) Expected Insert Size (Kb)
pCri-18a + xynB NotI & XhoI 8.7 1.6
pET-28a(+) + xynC NotI & SalI 5.3 1.2
pCri-18a + xynD NotI & XhoI 8.7 1.5
a)
b)
c)

Figure 6: 1% agarose gel show­ing bands ob­tained af­ter dou­ble di­ges­tion. a) xynB con­struct was con­firmed by NotI and XhoI di­ges­tion. b) xynC was con­firmed by NotI and SalI di­ges­tion. c)xynD was con­firmed by NotI and XhoI di­ges­tion.

6. Sequencing: Please find the at­tached file of se­quenc­ing data for xynC, xynD.

a)
b)

Figure 7: Sequencing align­ments for XynC and XynD re­spec­tively

7. Protein Induction: For pro­tein ex­pres­sion of the cloned gene we trans­formed the con­structs in the BL21 com­pe­tent cells. BL21 is an E.coli strain which is com­monly used in labs for pro­tein in­duc­tion.

a)
b)
c)

Figure 8: Plates show­ing colonies ob­tained af­ter the trans­for­ma­tion of a) the cloned xynB b) cloned xynC and c) cloned xynD into BL21 cells for pro­tein in­duc­tion.

Ligninase

Cloning of Ligninase (Bacillus sub­tilis Dye-decolorizing per­ox­i­dase; BsDyp):

1. Amplification of BsDyp(BBa_K1336003) :

We am­pli­fied the BsDyP(BBa_K1336003) gene from the ge­nomic DNA of Bacillus sub­tilis-168. We am­pli­fied this us­ing Thermofisher Phusion™ High-Fidelity DNA Polymerase via PCR us­ing Forward and Reverse primers with NotI and SalI re­stric­tion sites.

Forward Primer - 5’ACGCGTCGACATGAGCGATGAACAGAAAAAGC 3’ (Sal1)

Reverse Primer - 5’AAGGAAAAAAGCGGCCGCTTATGATTCCAGCAAACGC 3’(Not1)

Figure 1. This fig­ure shows the am­pli­fi­ca­tion of BsDyp us­ing PCR. The marked band at 1.2 kb in­di­cates the BsDyp am­pli­con.

2. Digestion, Ligation and Transformation of BsDyp: Amplified BsDyP (BBa_K1336003) was di­gested with NEB High-Fidelity en­zymes, NotI, and SalI. Similarly, pET-28a(+) was also di­gested with NotI and SalI so that com­pat­i­ble ends could be ob­tained.

a)
b)

Figure 2: a) Gel im­age of di­gested vec­tor b) Plate im­age shows colonies ob­tained af­ter the trans­for­ma­tion of the con­struct, BsDyP which was lig­ated in the pET-28a(+) vec­tor, into E. coli DH5ɑ cells.

Figure 3 : Colony PCR of 9 colonies picked from the plate shown in Figure 2. The ex­pected size for pos­i­tive colonies con­tain­ing BsDyp was 1251bp. All lanes ex­cept lane 7 gave the ex­pected size band

Figure 4 : Agarose gel show­ing the prod­ucts of dou­ble di­ges­tion of BsDyP in pET-28(+) us­ing NotI and SalI. Two bands of the size 5.3 kb and 1.25 kb were ob­tained as ex­pected.

Figure 5 : Sequencing data of BsDyP.

Pectinase

Cloning of pectin methyl es­terase (BBa_K4382008) gene in pCri-18a vec­tor

1: Amplification of pectin methyl es­terase gene

Our team re­ceived the Pectinase Gene Construct which we got syn­the­sized from IDT.

The Construct con­tained pectin methyl es­terase gene(BBa_K4382008). We am­pli­fied this us­ing Thermofisher Phusion™ High-Fidelity DNA Polymerase via PCR us­ing Forward and Reverse primers with NotI and XhoI re­stric­tion sites, re­spec­tively. The primers used for PCR Amplification were:-

Forward:- GCTCTAGAGCGGCCGCAAGGAGGAAGGATCAATGATTCAAAAACG (NotI)

Reverse:- CCGCTCGAGTCAATTCCCAGATCCGGCG (XhoI)

(The re­stric­tion sites are high­lighted)

Fig. 1: PCR am­pli­fi­ca­tion of Pectin methyl es­terase(BBa_K4382008) gene us­ing the syn­the­sized IDT frag­ment as a tem­plate and NotI, XhoI re­stric­tion site con­tain­ing for­ward and re­verse primers. The PCR prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific). The bands ob­tained in lanes 1,2, and 3 are at 1.2kb, in­di­cat­ing suc­cess­ful am­pli­fi­ca­tion of our gene of in­ter­est.

The band was then cut and eluted from the gel. Its con­cen­tra­tion was found to be 45ng/μl.The eluted prod­uct was then di­gested with NEB High-Fidelity NotI and XhoI to get the di­gested in­sert DNA, fol­low­ing which PCR cleanup was done.

2: Digestion of Plasmid

The plas­mid, pCri-18a, was di­gested with NEB High-Fidelity NotI and XhoI en­zymes. The di­gested pCri-18a vec­tor was gel eluted and the con­cen­tra­tion of plas­mid was ob­tained as 80ng/μl.

Fig. 2: Double Digestion of pCri-18a with NEB High-Fidelity NotI and XhoI re­stric­tion en­zymes.The di­gested prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific).Arrow in­di­cates band ob­tained af­ter dou­ble di­ges­tion

3: Ligation of Insert and Vector

The di­gested DNA in­sert and pCri-18a vec­tor were lig­ated with NEB T4 DNA Ligase. The lig­a­tion re­ac­tion was per­formed with in­sert:vec­tor ra­tios of 1:1, 3:1, 5:1 for 14 hours at 25°C along with a neg­a­tive con­trol (ligating only the di­gested plas­mid).

After the lig­a­tion re­ac­tion, 10μl of each of the the lig­ated mix­tures were trans­formed in 100μl of DH5A com­pe­tent cells and then plated on Agar plates with ampi­cillin (100μg/μl) as a se­lec­tion marker.

Fig. 3 (a): Transformation of 1:1 lig­a­tion mix­ture in DH5A. (b): Bacterial plate of Negative con­trol

18 to 20 colonies were ob­served on the 1:1 lig­a­tion plate and 8-10 colonies were ob­served in neg­a­tive con­trol plate.7 colonies out of the 1:1 lig­a­tion plate were screened for cloning con­fir­ma­tion

4: Confirmation of Insertion

4.1: cPCR with Taq poly­merase was per­formed to check if the pectin methyl es­terase(BBa_K4382008) has been cloned in the pCri-18a vec­tor

Fig. 4.1:. cPCR was per­formed for the 7 bac­te­r­ial colonies from the 1:1 lig­a­tion bac­te­r­ial plates.The PCR prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific). Lanes 1 to 7 show the cPCR prod­ucts of the 7 bac­te­r­ial colonies.Lanes 1, 2, 3, 5, 6, and 7 show a band at 1.2kb which in­di­cates that our gene has been cloned in pCri-18a vec­tor in these colonies.

4.2: Plasmids were ex­tracted from the pos­i­tive colonies, then di­gested with NEB High-Fidelity NotI and XhoI to dou­ble con­firm the cloning process

Fig. 4.2: Double Digestion of the Pectin methyl es­terase (BBa_K4382008) gene in­serted in pCri-18a vec­tor with NEB High-Fidelity NotI and XhoI re­stric­tion en­zymes. The di­gested prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific). Lanes 1 to 3 show 2 bands: the top 8.7kb band shows the pCri-18a plas­mid and the lower 1.2kb band in­di­cates the cloned pectin methyl es­terase gene.

Glycerol stock was pre­pared of the pos­i­tive bac­te­r­ial colonies.Af­ter this con­fir­ma­tion, 2μl of the cloned pCri-18a was trans­formed into 100μl of com­pe­tent BL-21 cells and plated on Agar plates with ampi­cillin (100μg/μl) as a se­lec­tion marker.

Figure 4.3: Transformation of the con­struct con­tain­ing Pectin methyl es­terase(BBa_K4382008) gene in­serted in pCri-18a vec­tor into BL21 cells

Experiments with Bacillus sub­tilis subsp. str. 168

1. Transformation of Bacillus sub­tilis 168 We have cloned XynD(BBa_K4382005) and pectin Methyl Esterase(BBa_K4382008) gene in pCri-18a plas­mid. Thus we have trans­formed these cloned pCri-18a plas­mid into Bacillus sub­tilis 168. We have also made a neg­a­tive con­trol plate(No plas­mid trans­for­ma­tion).

The de­tailed trans­for­ma­tion pro­to­col can be found here.

a)
b)
c)

Figure. 1 Bacterial Plate show­ing colonies ob­tained af­ter the suc­cess­ful trans­for­ma­tion of the cloned pCri-18a plas­mid into Bacillus sub­tilis A)7 colonies were ob­tained in the XynD(BBa_K4382005) cloned pCri-18a plas­mid. B) 2 colonies were ob­tained in the Pectin Methyl es­terase (BBa_K4382008)cloned pCri-18a plas­mid C) No colonies were ob­tained in the Negative Control Plate

Figure. 2 1% of Agarose gel show­ing the PCR prod­uct of Pectin Methyl es­terase (BBa_K4382008) and XynD(BBa_K4382005)from colonies ob­tained from trans­formed Bacillus sub­tilis. The colonies ob­tained were picked and lysed fol­lowed by PCR am­pli­fi­ca­tion us­ing gene spe­cific primers as in pro­to­col.

Cloning Summary

Gene Gene Size Vector Transformation in B.Subtilis
xynB (BBa_K4382003) 1602 bp pCri-18a In progress
xynC(BBa_K4382004) 1269 bp pET-28a(+) In progress
xynD(BBa_K4382005) 1542 bp pCri-18a Successfully trans­formed
BsDyP(BBa_K1336003) 1251 bp pET-28a(+) In progress
Pme (BBa_K4382008) 1191 bp pCri-18a Successfully trans­formed

Activity test of en­gi­neered bac­te­ria

Lignin is one of the most re­cal­ci­trant ma­te­ri­als pre­sent in the plant cell walls, which is very dif­fi­cult to de­grade. Lignin in­ter­links with other car­bo­hy­drates like cel­lu­lose, hemi­cel­lu­lose, and xy­lans to form a strong mesh. We wanted to test the ac­tiv­ity of our en­gi­neered bac­te­ria with en­hanced ex­pres­sion of the lign­i­nase and xy­lanase genes in vitro. To in­ves­ti­gate this, we treated chopped wheat straw with our en­gi­neered bac­te­r­ial cul­tures.

(a)
(b)
(c)

Figure 1: a) Safranin test to de­tect lignin in the con­trol sus­pen­sion with­out bac­te­r­ial in­ocu­lums gave pink­ish-red color, whereas the test (with bac­te­r­ial in­ocu­lums) did not show any sig­nif­i­cant color change. b) The com­pound lignin ex­tracted by chem­i­cal treat­ment of straw cor­re­sponds to con­trol. c) A com­pound ex­tracted by chem­i­cal treat­ment of straw cor­re­spond­ing to bac­te­r­ial in­ocu­lum treat­ment.

We used the clones ob­tained, XynC (BBa_K4382004) and BsDyP (BBa_K1336003), to treat the wheat straw. After treat­ment for 24 hours, we pro­ceeded with a safranin test to de­tect the pres­ence of in­tact lignin. We ob­served a change in the colour of our con­trol bac­te­r­ial sus­pen­sion as com­pared to that of bac­te­r­ial in­ocu­lum-treated straw (test). This in­di­cates the ab­sence of lignin in the test sus­pen­sion, which might be pos­si­bly due to the ac­tion of BsDyP ((BBa_K1336003)). We also ob­served a change in lignin mass from the treated straw (b and c). The bac­te­r­ial in­ocu­lum-treated straw ex­trac­tion mass is 0.67125 gm from 1gm of straw, whereas the con­trol straw could yield 0.832gm lignin. This in­di­cates the lignin con­tent in treated straw is more de­graded than the con­trol.

(a)
(b)

Figure 2:
(a) In the Safranin test, lignin was de­tected for the con­trol straws (left) but it was not de­tected for the test straw (middle). Pure Safranin (right) was taken as an ex­per­i­men­tal con­trol.
(b) The bac­te­r­ial cul­ture cor­re­spond­ing to the test gives a pos­i­tive test by giv­ing an or­ange colour with 2,4 DNP, in­di­cat­ing that the lignin is de­graded, whereas no colour change is ob­served in the con­trol, in­di­cat­ing that the lignin is not de­graded.

We fur­ther pro­ceeded with the straw for the lignin de­tec­tion test. We did not ob­serve any change in lignin con­tent in the con­trol and test. Since the lignin con­tent var­ied in the su­per­natant ob­tained af­ter de­com­po­si­tion, we pro­ceeded with the 2,4-DNP test to de­tect the pres­ence of aro­matic com­pounds. the test ex­tract showed a change in color, in­di­cat­ing the pres­ence of aro­matic com­pounds. This es­tab­lishes the fact that our straw treated with BsDyP ex­pres­sion con­struct is able to de­grade lignin and for­ward the re­ac­tion to the for­ma­tion of aro­matic com­pounds.

Link to cal­cu­la­tions

Bioplastics

1. Extraction of Vanillin from Wheat Straw us­ing the Nitrobenzene Oxidation (NBO) Method

The fol­low­ing are the ob­ser­va­tional re­sults:

Part 01: Extraction of Lignin from Wheat Straw: We ex­tracted the lignin from wheat straw us­ing white liquor (NaOH and Na2S), and be­low are the re­sults that we ob­tained:

  1. Mass of Lignin Extracted from 10 grams of wheat Straw: 3.152 grams (31.52 %)

  2. Safranin Dye changes color from Deep Red to Pink in pres­ence of lignin

a)
b)

Figure 1. (a) 3.152 grams of dried Lignin is ex­tracted and stored. (b) Lignin tested pos­i­tive with Safranin Dye (appearance of pink color).

Part 02: Synthesis of Vanillin from ex­tracted Lignin:

Once Lignin is ex­tracted, we treated it fur­ther fol­low­ing the ni­troben­zene ox­i­da­tion method to get the Vanillin and be­low are the re­sults that we ob­tained:

  1. Determination of Vanillin (from 1.5 grams of Lignin):
  • Mass of Empty Vial = 3.300 grams
  • Mass of Vial with Compound (Containing Side Products) = 3.401 grams
  • Mass of Compound (Including Side Products): 3.401 — 3.300 = 0.101 grams

Figure 2. The Final ex­tracted Vanillin is stored in a vial

To con­firm the pres­ence of Vanillin in our com­pound, we tested the com­pound on TLC against Laboratory — grade Vanillin us­ing 10%, 20%, 30%, and 40% EtOAc/Hexane so­lu­tion as elu­ent re­spec­tively. Pure - ‘pure Vanillin’ , Co — spot­ting — mix­ture of com­pound and pure vanillin , Compound — prod­uct ob­tained through ex­per­i­ments.

Figure 3. (a) TLC plate un­der UV to check UV ac­tive Compounds, (b) TLC plate af­ter stain­ing with 2,4-DNP Solution to test the pres­ence of Vanillin. 40% EtOAc/Hexane so­lu­tion was used as elu­ent.

NOTE: Other TLC Tests are at­tached in the Detailed Report.

2. Formation of Acetyl fer­ulic acid from Vanillin and fur­ther poly­mer­iz­ing it us­ing Zinc Acetate

We treated Vanillin fur­ther us­ing Sodium Acetate and Acetic Anhydride to get the acetyl fer­ulic acid and poly­mer­ized it us­ing Zinc Acetate. Below are the re­sults that we ob­tained:

  1. Mass of Acetyl fer­ulic Acid:
  • Mass of Butter Paper = 0.249 g

  • Mass of Paper + Compound = 0.921 g

  • Mass of Compound = 0.921 — 0.249 = 0.672 g

  1. Mass of Polymer from 0.672g of Acetyl fer­ulic Acid:
  • Mass of Empty Vial = 1.11 g

  • Mass of Vial con­tain­ing the poly­mer = 1.46 g

  • Mass of Polymer = 0.350 g

a)
b)

Figure 4. (a) Acetyl Ferulic Acid, (b) poly­mer­ized Acetylferulic acid

3. Formation of Bioplastic us­ing poly­mer­ized Acetyl fer­ulic acid and test­ing it

Once the poly­mer is crushed and pow­dered, we mixed it with Glycerol and left over straws to get the bio­plas­tic mould.

a)
b)

Figure 5. (a) Once dried, 1 mm sheet of Bioplastic is formed, (b) Top View of Bioplastic.

4. UPSCALING OBSERVATIONS AND ANALYSIS:

We per­formed the same ex­per­i­ments us­ing 7 gram Vanillin:

Experimental Results from Upscaling Step:

  1. Mass of Acetyl Ferulic Acid Formed: 5.394 g (0.689g pre­served for fu­ture use)

  2. Mass of Acetyl fer­ulic acid taken for fur­ther con­sid­er­a­tion: 4.705 g

  3. Mass of Polymer formed from 4.705 g of Acetyl fer­ulic Acid: 4.055 g

  4. Mass of Bioplastic formed from 4.055 grams of poly­mer: 5.304 g

a)
b)

Figure 6. (a) 4.055 poly­mer is formed out of 4.705 grams of acetyl fer­ulic acid, (b) Final Bioplastics, the orig­i­nal color is yel­low as shown, and green color is dyed to show that these plas­tics can also be dyed.

5.BIODEGRADATION TEST RESULTS

To test the degra­da­tion, we buried the known mass of bio­plas­tics in the soil and mea­sured it’s weight at reg­u­lar in­ter­vals. Following are the re­sults we ob­tained:

a)
b)
c)

Figure 7: (a) Initially, 0.1001g of bio­plas­tic is taken, (b) Bioplastic is wrapped in a mesh of 1mm in size, (c) Covered the bio­plas­tic with soil and sprayed the wa­ter to pro­vide the damp con­di­tions.

Mass of bio­plas­tic ( in g) Time ( in hours) Decomposition rate
0.1001 0 0
0.0904 24 9.69%
0.0847 48 6.31%
0.0768 72 9.32%
0.0725 96 5.59%
0.0658 120 9.24%

Figure 8: Plot de­scrib­ing the de­com­po­si­tion of Bioplastics with time

COMPARISON OF MICROBIAL GROWTH FROM SOIL WITH AND WITHOUT BIOPLASTIC LEFT FOR DECOMPOSITION IN IT

Without bio­plas­tic de­com­po­si­tion

Serial Number Dilution Factor Total Number of Colonies CFU/ml
1 100 144 1440
2 10−1 40 4000
3 10−2 8 8000

With bio­plas­tic de­com­po­si­tion

Serial Number Dilution Factor Total Number of Colonies CFU/ml
1 100 1208 12080
2 10−1 184 18400
3 10−2 28 28000
a)
b)
c)

Figure 9: Plate im­ages of mi­cro­bial colonies from ei­ther de­com­posed or un­de­com­posed bio­plas­tic.

A large num­ber of colonies were ob­served in the soil sam­ple taken from the box with de­com­pos­ing bio­plas­tic com­pared to the box just con­tain­ing the soil. Hence, bio­plas­tic in­creases mi­cro­bial growth in the soil in which it de­com­poses.

Bioplastic Report