Several dif­fi­cul­ties arose dur­ing our pro­ject, forc­ing us to re­con­sider our strate­gies. As we know that chang­ing of strate­gies are the in­te­gral part of any ex­per­i­men­tal re­search and can be con­sid­ered as a part of the en­gi­neer­ing cy­cle.

Cycle 1 #

Design #

In the be­gin­ning of our pro­ject, we de­cided to use Bacillus sub­tilis subsp. sub­tilis str. 168 as our chas­sis. We re­ceived the pCri-18a vec­tor from Dr. Sabari Thirupathy from IISER Trivandrum. To clone our genes of in­ter­est (GOI) we had to se­lect re­stric­tion sites in the MCS of the plas­mid. The main dif­fi­culty we faced while de­sign­ing the cloning ex­per­i­ments was that only the par­tial se­quence of pCri-18a was avail­able on­line.

Build #

The an­no­tated se­quence of pCri-18a was only of the MCS and from that se­quence we se­lected SalI and NotI as re­stric­tion en­zymes to clone the GOI in the plas­mid. Accordingly we or­dered the gene con­structs and gene primers from IDT with SalI (Forward flank) and NotI (Reverse flank) recog­ni­tion sites as the flank­ing se­quence so that we can di­gest our frag­ment and in­sert it into the di­gested plas­mid.

Test #

According to the par­tial se­quence, both the en­zymes NotI and SalI should only cut in the MCS.Thus when the plas­mid is dou­ble di­gested with NotI and SalI we ex­pect to get only one band of ~8.7kb. But we en­coun­tered a crit­i­cal is­sue when we di­gested the plas­mid with SalI and NotI re­stric­tion en­zymes. After di­ges­tion we ob­tained two bands of 7 kb and 1.7 kb in­di­cat­ing that there might be an ad­di­tional site for di­ges­tion by the en­zymes used.

Figure 1: Double di­ges­tion of pCri-18a with NEB High-Fidelity SalI and NotI re­stric­tion en­zymes. The di­gested prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific).

Single di­ges­tion with SalI was per­formed which showed that SalI is cut­ting at two sites in the plas­mid.

Figure 2: Single di­ges­tion of pCri-18a with NEB High-Fidelity SalI re­stric­tion en­zymes. The di­gested prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific). Arrow in­di­cates band ob­tained af­ter the di­ges­tion.

The two bands ob­tained in the gels in­di­cated that SalI had two re­stric­tion sites in the pCri-18a plas­mid. As the gene con­struct and gene primers were al­ready syn­the­sized from IDT, we were not able to change the SalI and NotI recog­ni­tion sites in the con­struct.

Learn / Solutions Implemented #

1) Partial di­ges­tion of pCri-18a #

We per­formed par­tial di­ges­tion of pCri-18a with NEB High-Fidelity SalI re­stric­tion en­zymes. For par­tial di­ges­tion the pro­to­col was mod­i­fied as be­low:-

Sample	Volume
SalI	0.2ul
pCri-18a	1ul (Concentration: 600ng/ul)
10X rCutsmart buffer	2ul
NFW	16.8ul
Total re­ac­tion vol­ume	20ul

The par­tial di­ges­tion re­ac­tion was op­ti­mized by in­cu­bat­ing 3 re­ac­tions mix­ture at $37\mathrm{°}C$ for 1 min, 2min and 3 min re­spec­tively.

Figure 3: Partial Digestion of pCri-18a with NEB High-Fidelity SalI re­stric­tion en­zymes. The di­gested prod­uct was run on 1% agarose gel along with 1 kb DNA lad­der (Thermo Scientific). Lane 1,2 and 3 in­di­cate in­cu­ba­tion of re­ac­tion mix­ture at $37\mathrm{°}C$ for 1 min,2min,3min re­spec­tively.

The band ob­tained at 8.7kb was cut and eluted. We then per­formed com­plete di­ges­tion of the prod­uct with NEB High-Fidelity NotI re­stric­tion en­zyme

Figure 4: Complete di­ges­tion of prod­uct with NEB High-Fidelity NotI re­stric­tion en­zyme.The di­gested prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific).The 8.7kb size band ob­tained in lane 1,2 and 3 rep­re­sent the par­tially di­gested plas­mid.

The 8.7kb band ob­tained rep­re­sents the cor­rectly di­gested pCri-18a plas­mid with SalI and NotI site in the MCS be­cause the length of our plas­mid is 8.7kb.

2) PCR us­ing newly syn­the­sized primers with NotI and XhoI re­stric­tion sites #

As SalI had two re­stric­tion sites in the plas­mid we de­cided to uti­lize the XhoI re­stric­tion site in the plas­mid in­stead of SalII. We newly de­signed primers with NotI and XhoI re­stric­tion sites to am­plify the gene frag­ments which we ob­tained from IDT so that the am­pli­fied gene frag­ments will con­tain flank­ing NotI and XhoI re­stric­tion site.

Pectin methyl es­terase (BBa_K4382008) was suc­cess­fully am­pli­fied and cloned in pCri-18a us­ing the newly de­signed primers be­low:-

Forward:- GCTCTAGAGCGGCCGCAAGGAGGAAGGATCAATGATTCAAAAACG (NotI)

Reverse:- CCGCTCGAGTCAATTCCCAGATCCGGCG (XhoI)

The de­tailed ex­per­i­men­tal re­sult for Pectin methyl es­terase(BBa_K4382008) will be found in the re­sult sec­tion

3) Changing the vec­tor to pET-28a(+) #

We also de­cided to use an­other vec­tor pET-28a(+) and clone some of the genes in this vec­tor.

Figure 5: Double Digestion of pET-28a(+) with NEB High-Fidelity SalI and NotI re­stric­tion en­zymes.The di­gested prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific). Arrow in­di­cates band ob­tained af­ter dou­ble di­ges­tion

pET-28a(+) vec­tor con­tains NotI and SalI re­stric­tion sites in the MCS and thus genes were cloned in the pET-28a(+) vec­tor.

We were suc­cess­fully able to clone xynA(BBa_K4382010), xynC(BBa_K4382004 and BsDyP(BBa_K1336003) genes by am­pli­fy­ing the genes from Bacillus sub­ti­tlis genome us­ing the old SalI and NotI primers and then cloning it in pET-28a(+) vec­tor.

The de­tailed ex­per­i­men­tal re­sult for all the above genes will be found in the re­sult sec­tion, for BBa_K1336003 click here and for Xylanase click here.

4) Sequencing of the pCri-18a plas­mid #

We were not able to find the whole pCri-18a plas­mid se­quence but only a par­tial se­quence of the MCS is avail­able on­line and thus we made a mis­take in choos­ing SalI re­stric­tion site as it is hav­ing two re­stric­tion site in the plas­mid. Thus we de­cided to search for the se­quence of the pCri-18a plas­mid that con­tains the ad­di­tional SalI site. We per­formed sanger se­quenc­ing of the plas­mid and ob­tained the se­quence of the spe­cific part.

Biobrick part (BBa_K4382015) is the se­quenced data which we ob­tained.

Cycle 2 #

Design #

Cloning lign­i­nase gene con­struct in pCri-18a plas­mid

Build #

We de­signed Forward and Reverse primers con­tain­ing NotI, XhoI re­stric­tion site re­spec­tively to am­plify the lign­i­nase gene.

Test #

We tried am­pli­fy­ing the Ligninase gene by PCR us­ing the primers above,but most of the PCR re­ac­tions failed.Only once we were able to am­plify the Ligninase gene but the prod­uct ob­tained was in very low con­cen­tra­tion. We used the pri­mary am­pli­fied prod­uct as tem­plate for a sec­ondary am­pli­fi­ca­tion, but got sev­eral non­spe­cific bands.

Figure 6: PCR am­pli­fi­ca­tion of Ligninase gene con­struct us­ing the syn­the­sized IDT frag­ment as a tem­plate and NotI, XhoI re­stric­tion site con­tain­ing for­ward and re­verse primers. The PCR prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific).The bands ob­tained in lanes 1 and 2 are at 2.3 kb, in­di­cat­ing suc­cess­ful am­pli­fi­ca­tion of our gene of in­ter­est

Learn / Solutions Implemented #

We thus de­cided to use the al­ter­na­tive method and am­plify the BsDyP(BBa_K1336003) gene from the genome of Bacillus Subtilis 168 us­ing the pre­vi­ously or­dered primers con­tain­ing SalI and NotI re­stric­tion sites.

Figure 7: PCR am­pli­fi­ca­tion of BsDyP gene us­ing Bacillus sub­tilis genome as a tem­plate and SaII, NotI re­stric­tion site con­tain­ing for­ward and re­verse primers. The PCR prod­uct was run on 1% agarose gel along with 1kb DNA lad­der (Thermo Scientific).The bands ob­tained in lanes 1 to 5 are at 1.25 kb, in­di­cat­ing suc­cess­ful am­pli­fi­ca­tion of our gene of in­ter­est

The gene was then di­gested with SalI and NotI and cloned into pET-28a(+) vec­tor and trans­formed into E. coli DH5A cells.

The de­tailed ex­per­i­men­tal re­sult for BsDyP(BBa_K1336003) gene will be found in the re­sult sec­tion here.