All materials used in the construction of FIAT LUX are indexed in this page.
| Bacterial Strain | Source or Reference |
|---|---|
| E. coli DH5α 𝜆pir | Laboratory collection |
| E. coli MFDpir | Ferrières et al, 2010 |
| Dickeya solani DS0432-1 | Laboratory collection |
| Citrobacter rodentium RLC2 | Gueguen et al, 2013 |
| Pseudomonas putida KT2440 | Nelson et al, 2002 |
| Vibrio natriegens | Weinstock et al, 2016 |
| Pseudomonas protegens CHA0 | Jousset et al, 2014 |
| Plasmid | Relevant characteristics | Source or Reference |
|---|---|---|
| pGEX(−) | GST-deleted pGEX-6P-1, pUC origin, AmpR | Gregor et al. 2018 |
| pGEX(−)-ilux | iluxCDABE-frp in pGEX(−) | Gregor et al. 2018 |
| pWSK129 | ori pSC101, AmpR | Wang et al. 1991 |
| pSB1C3 | ori pMB1, CmR, 2070 bp | iGEM |
| pSB1C3-fiatluxABE | CmR, fiatluxABE without promoter in pSB1C3 | this study |
| pBAD18 | ori colE1, high copy vector, KanR, arabinose inducible promoter pBAD | Guzman LM et al. 1995 |
| pBAD18-fiatluxABE | KanR, fiatluxABE under pBAD promoter in pBAD18-kan | Guzman LM et al. 1995 |
| pACYDuet-1 | ori p15A, CmR, 4008bp | Novagen (EMD Millipore) |
| pACYDuet-1fiatluxCD | CmR, fiatluxCD under J23117 promoter in pACYDuet-1 | Guzman LM et al. 1995 |
| pSEVA521 | ori RK2, low-copy vector, TetR, 4160bp, conjugative | Silva-Rocha, Martinez-Garcia et al. 2013 |
| pSEVA521-fiatluxCDABE | TetR, fiatluxCDABE under J23117 promoter in pSEVA521 | this study |
| pSEVA531 | ori pBBR, low-copy vector, TetR, 3460bp, conjugative | Silva-Rocha, Martinez-Garcia et al. 2013 |
| pSEVA531-fiatluxCDABE | TetR, fiatluxCDABE under J23117 promoter in pSEVA531 | this study |
| pSEVA221 | ori RK2, low-copy vector, KmR, 3823 | Silva-Rocha, Martinez-Garcia et al. 2013 |
| pSEVA221-fiatluxCDABE | KmR, fiatluxCDABE under J23117 promoter in pSEVA221 | this study |
| Pairs name | 5’ to 3’ primer sequence | Purpose |
|---|---|---|
| L1399-forward | GATAACAATTTCACACAGGAAACAGGATCCATGACTAAAAAAATTTC | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1389-reverse | ACCTGTCGCCGCAGACGTCAAATCAACAGG | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1390-forward | ACGTCTGCGGCGACAGGTGCGGCTC | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1391-reverse | CTTCAAAATCCAGATTATTCGGCAATTCATTAATGG | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1392-forward | CGAATAATCTGGATTTTGAAGGCCATAAATTGG | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1393-reverse | CAAATTTCATGTATTCAGAGAGTCCTTATATTGC | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1394-forward | CTCTCTGAATACATGAAATTTGGAAACTTTTTAC | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1395-reverse | ACTCACAACCTGGAGCATGGATGAGCTTGAAGC | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1396-forward | CATGCTCCAGGTTGTGAGTATAATTCGG | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1397-reverse | TTGCCCGCAGTTTCCTGGGACCAG | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1398-forward | CAGGAAACTGCGGGCAAGCTGGCCGGAGAA | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1400-reverse | GTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTC | Used in the overlap PCR to assemble fiatluxCDABE together |
| L1538-forward | ttgtgctagcTCACACAGGAAACAGGATCCATGACTAAAAAAATTTCATTCATTATTAACG | Amplification of luxCDABE with primers, PCR on colonies |
| L1542-reverse | gagtccaagaCTGCAGCGGCCGCTACTAGTATCAACTATCAAACGCTTCGGTTAAG | Amplification of luxCDABE with primers, PCR on colonies |
| L1540-forward | ctagagTCACACAGGAAACAG | pSEVA531-fiatlux, Bba_J23117 promoter removal: annealing of 2 primers to close back the plasmid |
| L1541-reverse | ctagagTCACACAGGAAACAG | pSEVA531-fiatlux, Bba_J23117 promoter removal: annealing of 2 primers to close back the plasmid |
| L707 | agcggataacaatttcacacagga | pSEVA531-fiatlux sequencing |
| L1153 | cctggattctcaccaataaaaaacgcc | pSEVA531-fiatlux sequencing |
| Promoter name | Characteristics | 5' to 3' sequence | Length |
|---|---|---|---|
| J-23117 | constitutive promoter family member | agctagctcagtcctagggattgtgctagc | 35 bp |
| pBAD | arabinose inducible promoter pBAD |
ATGGAGAAACAGTAGAGAGTTGCGATAAAAAGCGTCAGGTAGGATCCGCT AATCTTATGGATAAAAATGCTATGGCATAGCAAAGTGTGACGCCGTGCAA ATAATCAATGTGGACTTTTCTGCCGTGATTATAGACACTTTTGTTACGCG TTTTTGTCATGGCTTTGGTCCCGCTTTGTTACAGAATGCTTTTAATAAGC GGGGTTACCGGTTTGGTTAGCGAGAAGAGCCAGTAAAAGACGCAGTGACG GCAATGTCTGATGCAATATGGACAATTGGTTTCTT | 277 bp |
Imaging systems:
Microplate readers:
Ferrières L, Hémery G, Nham T, Guérout AM, Mazel D, Beloin C, Ghigo JM. Silent mischief: bacteriophage Mu insertions contaminate products of Escherichia coli random mutagenesis performed using suicidal transposon delivery plasmids mobilized by broad-host-range RP4 conjugative machinery. J Bacteriol. 2010 Dec;192(24):6418-27. doi: 10.1128/JB.00621-10. Epub 2010 Oct 8. PMID: 20935093; PMCID: PMC3008518.
Gueguen E, Cascales E. Promoter swapping unveils the role of the Citrobacter rodentium CTS1 type VI secretion system in interbacterial competition. Appl Environ Microbiol. 2013 Jan;79(1):32-8. doi: 10.1128/AEM.02504-12. Epub 2012 Oct 12. PMID: 23064344; PMCID: PMC3536073.
Nelson, K.E., Weinel, C., Paulsen, I.T., Dodson, R.J., Hilbert, H., Martins dos Santos, V.A.P., Fouts, D.E., Gill, S.R., Pop, M., Holmes, M., Brinkac, L., Beanan, .M., DeBoy, R.T., Daugherty, S., Kolonay, J., Madupu, R., Nelson, W., White, O., Peterson, J., Khouri, .H., Hance, I., Lee, P.C., Holtzapple, E., Scanlan, .D., Tran, K., Moazzez, A., Utterback, T., Rizzo, .M., Lee, K., Kosack, D., Moestl, D., Wedler, H., Lauber, J., Stjepandic, D., Hoheisel, J., Straetz, M., Heim, .S., Kiewitz, C., Eisen, J., Timmis, K.N., Düsterhöft, .A., Tümmler, B. and Fraser, C.M. (2002), Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environmental Microbiology, 4: 799-808. https://doi.org/10.1046/j.1462-2920.2002.00366.x
Weinstock, M., Hesek, E., Wilson, C. et al. Vibrio natriegens as a fast-growing host for molecular biology. Nat Methods 13, 849–851 (2016). https://doi.org/10.1038/nmeth.3970
Jousset Alexandre; Schuldes Joerg; Keel Christoph; Maurhofer Monika; Daniel Rolf; Scheu Stefan; Thuermer Andrea. Full-Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas Protegens CHA0. Genome Announc. 2014, 2 (2), e00322-14. https://doi.org/10.1128/genomeA.00322-14.
Rong Fu Wang; Kushner, S. R. Construction of Versatile Low-Copy-Number Vectors for Cloning, Sequencing and Gene Expression in Escherichia Coli. Gene 1991, 100, 195–199. https://doi.org/10.1016/0378-1119(91)90366-J.
↑