Parts overview

Plasmids

As a donor plasmid we used pJET 1.2 / blunt, which was kindly provided to us by Jo-Anne Verschoor. This vector contains the lethal restriction enzyme gene Eco47I / T7, which can be disrupted by ligating a DNA insert into the cloning site. The bacterial cells containing the lethal gene will then not be able to form colonies, while the ones containing the recombinant plasmid will form colonies, allowing for a quick and easy screening.

The DNA sequences were cloned into the recipient plasmid pET-16b. It was kindly provided to us by Bas van Woudenberg. This plasmid was selected, as it is a standard low-copy number plasmid, reducing the metabolic burden imposed on the host cell. It was important to us to minimize this, as our bacteria will already be stressed out by the silver and gold salts added. Other features that were important in choosing this vector were:

• Selection marker:
  • An ampicillin resistance gene was present to select for the transformed E. coli. Selection was made by using a medium supplemented with the antibiotic ampicillin.
• Inducible expression system, containing:
  • A multiple cloning site, where we inserted our gene sequence by digesting the plasmid with the restriction enzymes BamHI and NdeI.
  • A T7 promoter to initiate the transcription of our genes by adding the chemical reagent Isopropyl β-D-1-thiogalactopyranoside (IPTG).
  • The lacI gene to synthesize the lac repressor Lacl.
  • A LacO site that contains a lac operator sequence. If IPTG is absent, Lacl binds to this site to prevent the expression of our gene of interest.

CUP1

The sequence for cup1 from Candida albicans (C. albicans), which encodes metallothionein (more information can be found under project description), was obtained from Uniprot¹. C. albicans was chosen, as it was previously shown that it can enhance synthesis of silver nanoparticles. The sequence was optimized for E. coli. Then two overhang sequences with the restriction enzymes BamHI and NdeI were designed to make the insert compatible with the pET-16b vector (Table 1). During the design of the overhangs, various properties were taken into account such as stop codons, annealing temperature, GC content and the length. The part BBa_K4259000 is the DNA sequence including those two restriction sites.

CopA and NapA

The sequences from copA and napA (more information on them can be found under project description), both from Cupriavidus metallidurans (C. metallidurans), were obtained from Uniprot¹. They were subsequently codon optimized for the host bacterium E. coli. As in the previous construct, two overhang sequences were added (Table 1), one containing the restriction site for BamHI and one containing the restriction site for NdeI. The parts BBa_K4259002 (napA) and BBa_K4259003 (CopA) are the DNA sequences including those two restriction sites.

Table 1 | Added overhang sequences with highlighted restriction sites

Part	Overhang BamHI (3’ to 5’)	Overhang NdeI ( 3’ to 5’)
cup1	GTGCTTCCAAAAAATAAGGATCCTACACTGATTGAC	TCTGGCTGCTCGTCACTCATATGTCTAAATTCG
copA	AAACTAACGCCTAGGGATCCGC	TCCCGTCGCTCATATGCA CAGTCG
napA	AGCGGATCCTTAGACCTTGACAATTTTTACTGCGCATTTTTTAAAATCGG	ATGTCAGTCCCGTCGCTCATATGCCTTTGACACGC

ASKA collection

Additionally, four different genes from the ASKA collection, which is a set of ORFs cloned from E. coli K12 into the plasmid pCA24N, were used. The selected genes were copA, napA, cueO, and melA. The ASKA plasmids were isolated, and they were then transformed into E. coli BL21. This was done to have comparable and reproducible data to our constructs, as they are also expressed in the BL21 strains. For copA, napA, and cueO we created new entries in the iGEM registry to show how they can be used for nanoparticle production.

Table 2 | Overview new parts

Name	Type	Description	Designers	Length (bp)
BBa_K4259000	Basic	cup1 gene from C. albicans codon optimized for E. coli	Jennifer Adami	143
BBa_K4259002	Basic	napA gene from C. metallidurans codon optimized for E.coli	Jennifer Adami	2536
BBa_K4259003	Basic	copA gene from C. metallidurans codon optimized for E.coli	Jennifer Adami	2500
BBa K4259004	Basic	cueO gene from E. coli	Kitagawa et. al	1548
BBa_K4259005	Basic	copA gene from E. coli	Kitagawa et. al	2502
BBa_K4259006	Basic	napA gene from E.coli	Kitagawa et. al	2484

In parallel, we used melA for nanoparticle production and were able to add additional information and further characterize the already existing part BBa_K274001.

Name	Type	Description	Length (bp)	Created by
BBa_K274001	Basic	Melanin Pigment	1844	Concordia iGEM team 2016