↑
results
↓
Result
Module1:Screening and identification of genes

Determination of the pathway:

  In plants, there are two pathways for GABA synthesis and conversion: one is the synthesis of GABA from Glutamic acid catalyzed by glutamic acid decarboxylase (GAD), called the GABA shunt; the other is the conversion of polyamine degradation products to form GABA, called the polyamine degradation pathway.
  In higher plants, the metabolism of GABA is mainly accomplished by three enzymes, firstly, the irreversible decarboxylation of L-glutamic acid (Glu) at the α-position under the action of GAD to form GABA, and then the reaction of GABA with pyruvate and α-ketoglutarate catalyzed by GABA transaminase (GABA-T) to form succinate. Then, GABA reacts with pyruvate and α-ketoglutarate to form succinic semialdehyde, and finally succinic semialdehyde dehydrogenase (SSADH) catalyzes the oxidative dehydrogenation of succinic semialdehyde to form succinic acid, which finally enters the tricarboxylic acid cycle (krebs circle). This metabolic pathway constitutes a branch of the TCA cycle, called the GABA branch. result1

  In plants, GAD presents in the cytoplasm and GABA-T and SSADH in the mitochondria together regulate the metabolism of the GABA branch, where GAD is the rate-limiting enzyme for GABA synthesis. Plant GAD contains a calmodulin (CaM) binding region, and GAD activity is not only co-regulated by Ca2+ and H+ concentrations, but also influenced by the concentration of the GAD coenzyme, pyridoxal phosphate (PLP), and the substrate glutamate. This dual regulatory mechanism links the cellular accumulation of GABA to the nature and severity of environmental stresses. Cold stress, heat stress, osmotic stress and mechanical injury all increase the Ca2+ concentration in the cytosol, and Ca2+ binds to CaM to form the Ca2+/CaM complex, which is capable of stimulating GAD gene expression and increasing GAD activity under normal physiological pH conditions; whereas acidic pH stimulates the appearance of GAD as a result of stress lowering the pH of the cell and slowing down the acidic harm to the cell. The GABA branch in plants is considered to be the main pathway for GABA synthesis. Currently, most studies have focused on how to increase GAD activity to achieve GABA enrichment.
  Therefore, we chose the pathway of GABA generation from glutamate catalyzed by GAD in the GABA branch. result2

GAD and CaM gene screening:

  By using the CaM gene of Arabidopsis as the search object, we used the BLAST function of TBtools to compare the CaM genes in longan in the three-generation genome database of longan, kept all the IDs of the screened CaM, extracted the corresponding protein sequences using the Fasta Extract function of TBtools, and constructed the CaM genes in Arabidopsis and rice by MEGA7.0 We found that only two DlCaM genes were evolutionarily related to Arabidopsis and rice, and identified these two genes as the CaM genes we were looking for. Structural domain validation was performed to screen out sequences without CaM structural domains and EF-hand, and the resulting candidate protein IDs were used to obtain the protein, CDS and gene sequences of the CaM gene family by the sequence extraction tool of TBtools (Fasta Extract). Longan genome sequences, protein sequences, gDNA sequences and gff files were derived from our laboratory database. result3   The conserved structural domain analysis showed that all CaM gene family members contained the PTZ00184 structural domain, further supporting the correctness of the two selected longan CaM genes. result4   Both genes were used in the gene editing CRISPR-Cas9 knockdown experiments based on the expression profiles showing that both CaMs in Longan were highly expressed at all three stages of somatic embryogenesis. result5

GAD gene screening:

  The GAD gene of Arabidopsis was used as the search sequence, and the BLAST function of TBtools was used for comparison analysis, and the sequences with sequence similarity higher than 70% were retained, and the structural domain was verified by NCBI CDD search (https://www.ncbi.nlm.nih.gov/cdd) to screen out the sequences that did not contain the Glu-decarb-GAD protein structural domain, and finally four DlGAD genes were obtained. Among them, GAD2 is special, with a structural domain different from all other longan GAD genes. result6   Transcriptome analysis of six GAD genes revealed that the expression of GAD2 and GAD5 was high and GAD5 was differentially expressed, so these two genes were used for the construction of overexpression vectors. result7

Module2:Construction of GAD overexpression vector and CaM knockdown experiments

  Through a series of experiments, we successfully constructed an overexpression vector for GAD and a pGW3 vector (Source: The New Zealand Institute for Plant and Food Research Limited) for knocking out CaM.

Construction of GAD overexpression vector

1.1 PCR amplification
①Primer

ID Rename F/R Primer Tm Enzyme cut site
GAD2 F GGGGTACCATGGCTCAGACCGTTGCATATG 62.4 KpnⅠ
R ACGCGTCGACTCACTTATGGAGACCACAAGCACA 62.2 SalⅠ
GAD5 F CGGGGTACCATGGTGATATCTTCAACAACAGCG 61.1 KpnⅠ
R AACTGCAGTTAGCATGCTCCGGCTCTCC 62.7 PstⅠ

②Electrophoresis results
DlGAD2 result8 Figure 1:PCR amplification product of DlGAD2 The band marked in red is the band run for GAD2, and the length of GAD2 is 1428bp.
DlGAD5 result9 Figure 2 PCR amplification product of DlGAD5 As the figure is marked with red box is the band run out for GAD5, the length of GAD5 is 1473bp.
1.2 Fungal plate growth
The following pictures are all the colonies that grew after the plate was coated. result10 Figure 3 Bacteria plate 1.3 Colony PCR results result19 Figure 4 DlGAD2 bacteriophage PCR of Pcombia1301SN-DlGAD2 vector result11 Figure 5 DlGAD5 bacteriophage PCR of Pcombia1301SN-DlGAD2 vector So far, after sending the test to the biological company, we successfully cloned DlGAD2 and DlGAD5.
④Dual enzyme digestion result12 Figure 6 Enzyme-digested product

CRISPR/Cas9 knockdown DlCaM experiments

2.1 CaM knockdown experiments
①Plasmids
   The vector we used in our experiments was Genovo-W-3, commonly referred to as pGW3 (Source: The New Zealand Institute for Plant and Food Research Limited) . pGW3 has a fragment length of 16,654 bp. We cleaved it with BsaⅠ and gum recovered a fragment of size 15,429 bp, the pGW3 backbone. We used T4 ligase to ligate the sgRNA to the pGW3 backbone to obtain the recombinant plasmid. result13 Figure7: Genovo-W-3 plasmid mapping ②Enzyme digestion
   Plasmid pGW3 was digested with Bsa I:
result14 Figure 8 Enzyme-digested product ③Transform
   The ligation product was transformed into E. coli DH5α and coated on medium with kana.
result15 Figure9: Transformed colonies of pGW3-ΔDlCaM1 recombinant result16 Figure10: Transformed colonies of pGW3-ΔDlCaM2 recombinant vector ④Identification of positive clones
After 10 -12h, single clones were selected for colony PCR identification and sequencing to confirm whether the target was attached to the vector. The bacteriophage with correct PCR bands will be selected and a tube of large shake extracted plasmids will be sequenced. result17 Figure 11 Bacteriophage PCR result 2.2 Transformation and Infestation
①Transfer of recombinant plasmid into Agrobacterium result18 Figure12: pGW3-ΔDlCaM1 recombinant vector and pGW3-ΔDlCaM2 recombinant vector Agrobacterium bacteriophage PCR ②Infestation
   Agrobacterium tumefaciens carrying the recombinant plasmid was infiltrated into longan healing tissues and transiently transformed for 6 d. Our team is currently working on verifying the successful transfer of the recombinant plasmid into longan and will next test the GABA content in the gene edited longan healing tissues.

Module3:Exogenous processing results

   We completed experiments on the effects of transient high temperature stress and blue light treatment on the endogenous GABA content of Longan somatic embryos.
   We placed longan healing tissues in good growth condition (spherical embryo period) in a thermostat and a blue light incubator for adversity treatment, the temperature of the thermostat was adjusted to 40°C and the parameters of the blue light incubator were adjusted to 32umol-m-2-S-2, and the samples were collected every 5 min until 120 min, and the GABA content in the samples was measured according to the procedure of the purchased GABA kit. The following model was constructed based on the measured data, and the obtained data were analyzed by SPSS to obtain the results of significance level.
result20 Blue light processing result21 High temperature treatment    GABA is a kind of adversity protein, under the condition of adversity stress (blue light and high temperature stress), the content of GABA will first show an increasing trend, but this increasing trend does not last all the time, reaching a certain limit, this increasing trend begins to gradually change to a decreasing trend. Under blue light treatment conditions, the GABA content reached its peak at about 30 min of treatment, while under high temperature treatment conditions, the GABA content reached its peak at 45 min of treatment. We can rely on this conclusion to guide the production of high-yielding GABA cell factories by subjecting longan healing tissues to 30 min of blue light treatment and 45 min of high temperature treatment to increase the GABA content as a way to achieve high yield.
result22 result23 High temperature treatment result24 significance level (P=0.05) result25 Blue light treatment significance level (P=0.05)    According to the results given by SPSS software, the sample variance was significant at P=0.05, under the condition of blue light treatment, 0.035 <0.05, indicating that the variance between samples was chi-square, which also indicates that blue light treatment had a significant effect on GABA content in longan healing tissue; at P=0.05, under the condition of high temperature treatment, the sample variance was significant at 0.037 < 0.05, indicating that the variance between samples was chi-square, which could also indicate that high temperature treatment also had a significant effect on GABA content in longan healing tissues.

CONTACT US
Bilibili: FAFU-CHINA-2022
Email: 18750672830@163.com
Address: Fujian Agriculture and Forestry University
District: CangShan, Fuzhou
©2022 - Content on this site is licensed under a Creative Commons Attribution 4.0 International license.
The repository used to create this website is available at gitlab.igem.org/2022/fafu-china.