E. coli DH10B (taxid: 316385) was used for all routine cloning. LB–Broth medium was used for strain propagation. SOC medium was used for transformation recovery.
The structure of Transcriptional Unit 1 and Transcriptional Unit 2 is shown in Figure 1. They were designed and synthesized by Ailurus Bio. Single colonies were isolated for further characterization and were Sanger sequenced by 20 bp oligonucleotide (5'ACGCCCGGTAGTGATCTTAT).
In detail, 100 μl DH10B Chemically Competent Cells (TransGen) were transformed by Transcription Unit 1 and Transcription Unit 2 and then plated on plates containing LB + 2% agar and grown overnight at 37 °C. The plates were stored at 4 °C after growth.
3 single colonies were inoculated into 0.75 ml LB medium with 30 ng/μl chloramphenicol and 50ng/ul Spectinomycin for plasmid maintenance in 2ml 96 well deepwell plates (NEST). The plates were sealed with breathable Nunc Seals (Thermo Scientific) and incubated at 37 °C and 1000 r.p.m. overnight. The overnight cultures were diluted 1:325 into 750 μl LB medium with antibiotics in 2ml 96well deepwell plates (NEST); the plates were sealed with Nunc Seals and incubated at 37 °C and 1,000 r.p.m. After 3 h, Metal ions were then added at the following concentrations : 0 uM Cu(II), 0.5 uM Cu(II), 5 uM Cu(II), 50 uM Cu(II), 0.5 mM Cu(II), 5 mM Cu(II), 50 mM Cu(II). After mixing by pipetting, 100 μl cultures of each were transferred into 3 standard 96well plates respectively to set up replicates, sealed with Nunc Seals, and incubated at 37 °C and 1,000 r.p.m. for 16 h. Black 96Well Cell Culture Plates with Clear Bottom (In Vitro Scientific) were filled with a mixture of 10 μl overnight cultures and 90 μl PBS (Sangon Biotech). The optical density at 600 nm (OD600) and fluorescence readings (560 nm excitation wavelength and 605nm emission wavelength) were carried out on a Spark® Multimode Microplate Reader. Background signals of OD600 and fluorescence, measured from a clear medium, were subtracted from each measurement. Samples with OD600 insignificantly larger than the background were removed to eliminate operational error. mApple per cell was then calculated by dividing the mean fluorescence (A.U.) over the corresponding mean OD600.
E. coli DH10B (taxid: 316385) was used for all routine cloning. LB– Broth medium was used for strain propagation. SOC medium was used for transformation recovery.
The structure of Transcriptional unit 3 is shown in Figure 2 and was designed and synthesized at Ailurus Bio. Single colonies were isolated for further characterization and Sanger sequenced by 20 bp oligonucleotide (5’-ATAGGCGTATCACGAGGCAG).
In detail, 100 μl DH10B Chemically Competent Cells (TransGen) were transformed by Transcription Unit 3 and then plated on plates containing LB + 2% agar and grown overnight at 37 °C. Plates were stored at 4 °C after growth.
3 single colonies were inoculated into 0.75 ml LB medium with 50ng/ul Spectinomycin for plasmid maintenance in 2ml 96well deepwell plates (NEST). The plates were sealed with breathable Nunc Seals (Thermo Scientific) and incubated at 37 °C and 1000 r.p.m. overnight. The overnight cultures were diluted 1:325 into 750 μl LB medium with antibiotics in 2ml 96 well deepwell plates (NEST); the plates were sealed with Nunc Seals and incubated at 37 °C and 1,000 r.p.m. After 3 h, Metal ions were then added at the following concentrations: 0 uM and 50 uM Cu(II). After mixing by pipetting, 100 μl cultures of each were transferred into 3 standard 96 well plates respectively to set up replicates, sealed with Nunc Seals, and incubated at 37 °C and 1,000 r.p.m. for 16 h. Black 96 Well Cell Culture Plates with Clear Bottom (In Vitro Scientific) were filled with a mixture of 10 μl overnight cultures and 90 μl PBS (Sangon Biotech). The optical density at 600 nm (OD600) and fluorescence readings (560 nm excitation wavelength and 605nm emission wavelength) were carried out on a Spark® Multimode Microplate Reader. Background signals of OD600 and fluorescence, measured from a clear medium, were subtracted from each measurement. Samples with OD600 insignificantly larger than the background were removed to eliminate operational error. Protein expression was then calculated by dividing the mean fluorescence (A.U.) over the corresponding mean OD600.
E. coli DH10B (taxid: 316385) was used for all routine cloning. LB–Broth medium was used for strain propagation. SOC medium was used for transformation recovery.
The final structure of Transcription Unit 4 is shown in Figure 3. The synthetic promoter library (Ailurus Bio) and the RBS library were assembled into Transcription Unit 1 (Figure 1) by Golden Gate Assembly at Ailurus Bio. Single colonies were isolated for further characterization and Sanger sequenced by 20 bp oligonucleotide (5’-ACGCCCGGTAGTGATCTTAT). Notably, the same promoter sequence appeared in different clones.
In detail, the Promoter library and the RBS library were inserted into Transcription Unit 1 sequentially with BsaIHF®v2 (NEB) and T4 DNA Ligase (NEB) using the program: 37 °C for 5 min, 16 °C for 5 min, 60 cycles. The resulting products were cleaned up using TIANquick Midi Purification Kit (TIANGEN) and then cotransformed with transcriptional unit2 into 100 μl DH10B Chemically Competent Cell (TransGen) and then plated on plates containing LB + 2% agar and grown overnight at 37 °C. Plates were stored at 4 °C after growth.
96 single colonies were inoculated into 0.75 ml LB medium with 30 ng/μl chloramphenicol and 50ng/ul Spectinomycin for plasmid maintenance in a 2ml 96 well deepwell plate (NEST), The plates were sealed with breathable Nunc Seals (Thermo Scientific) and incubated at 37 °C and 1000 r.p.m. overnight. The overnight cultures were diluted 1:325 into 750 μl LB medium with antibiotics in 2ml 96well deepwell plates (NEST); the plates were sealed with Nunc Seals and incubated at 37 °C and 1,000 r.p.m. After 3 h, Metal ions were then added at the following concentrations: 0 uM Cu(II), 0.5 uM Cu(II), 5 uM Cu(II), 50 uM Cu(II), 0.5 mM Cu(II), 5 mM Cu(II), and 50 mM Cu(II). After mixing by pipetting, 100 μl cultures of each were transferred into 3 standard 96 well plates respectively to set up replicates, sealed with Nunc Seals, and incubated at 37 °C and 1,000 r.p.m. for 16 h. Black 96 Well Cell Culture Plates with Clear Bottom (In Vitro Scientific) were filled with a mixture of 10 μl overnight cultures and 90 μl PBS (Sangon Biotech). The optical density at 600 nm (OD600) and fluorescence readings (560 nm excitation wavelength and 605nm emission wavelength) were carried out on a Spark® Multimode Microplate Reader. Background signals of OD600 and fluorescence, measured from a clear medium, were subtracted from each measurement. Samples with OD600 insignificantly larger than the background were removed to eliminate operational error. Protein expression was then calculated by dividing the mean fluorescence (A.U.) over the corresponding mean OD600.
E. coli DH10B (taxid: 316385) was used for all routine cloning. LB–Broth medium was used for strain propagation. SOC medium was used for transformation recovery.
The final structure of Transcription Unit 5 is shown in Figure 4. The BBa_K1980004 mutant library was assembled into Transcription Unit 2 (Figure 2) by Golden Gate Assembly at Ailurus Bio. Single colonies were isolated for further characterization and Sanger sequenced by 20 bp oligonucleotide (5’-ATAGGCGTATCACGAGGCAG). Notably, the same promoter sequence appeared in different clones.
In detail, the BBa_K1980004 mutant library was assembled into Transcription Unit 2 sequentially with BsaIHF®v2 (NEB) and T4 DNA Ligase (NEB) using the program: 37 °C for 5 min, 16 °C for 5 min, 60 cycles. The resulting products were cleaned up using TIANquick Midi Purification Kit (TIANGEN) and then transformed into 100 μl DH10B Chemically Competent Cells (TransGen) and then plated on plates containing LB + 2% agar and grown overnight at 37 °C. Plates were stored at 4 °C after growth.
96 single colonies were inoculated into 0.75 ml LB medium with 50ng/ul Spectinomycin for plasmid maintenance in 2ml 96-well deepwell plates (NEST). The plates were sealed with breathable Nunc Seals (Thermo Scientific) and incubated at 37 °C and 1000 r.p.m. overnight. The overnight cultures were diluted 1:325 into 750 μl LB medium with antibiotics in 2ml 96well deepwell plates (NEST); the plates were sealed with Nunc Seals and incubated at 37 °C and 1,000 r.p.m. After 3 h, Metal ions were then added at the following concentrations: 0 uM Cu(II) and 50 uM Cu(II). After mixing by pipetting, 100 μl cultures of each were transferred into 3 standard 96 well plates respectively to set up replicates, sealed with Nunc Seals, and incubated at 37 °C and 1,000 r.p.m. for 16 h. Black 96 Well Cell Culture Plates with Clear Bottom (In Vitro Scientific) were filled with a mixture of 10 μl overnight cultures and 90 μl PBS (Sangon Biotech). The optical density at 600 nm (OD600) and fluorescence readings (560 nm excitation wavelength and 605nm emission wavelength) were carried out on a Spark® Multimode microplate Reader. Background signals of OD600 and fluorescence, measured from a clear medium, were subtracted from each measurement. Samples with OD600 insignificantly larger than the background were removed to eliminate operational error. Protein expression was then calculated by dividing the mean fluorescence (A.U.) over the corresponding mean OD600.