Read more about our experiment and protocols!
Amplification of nitrate reductase gene (nirS) from Pseudomonas azotoformans DNA DNA of Pseudomonas azotoformans (DSM 18862), strain LMG21611 isolated from paddies in Japan, was purchased from DSMZ Leibniz Institute (Germany). The nirS gene was amplified using PCR. The primers used were based on the NCBI reference sequence: NZ_LT629702.1 and were designed using Primer-3 software (Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M and Rozen SG. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012 Aug 1;40(15):e115.) In order to make directional cloning possible, the sites of two restriction enzymes were incorporated into the Primer sequence. The resulting Primers are: NirS-F 5' GTCAATCATATGCCCCCGACGGCCCAT3' NirS-R 5'TGGTGGTTCGAATCAATAAATATCGTGTTGGG3'. In the forward Primer the sequence for NDEI and at the reverse the HindIII restriction site sequence. The PCR reaction was performed using fusion high fidelity DNA polymerase master mix (Thermo scientific). The reaction mixture contained the following: 25 μl Fusion master mix, 5 μl DNA, 1.5 μl nirS-F Primer (10 mM), 1.5 μl nirS-R Primer (10 mM), and 17 μl PCR-grade water. The PCR program used was: 95o C for 5 minutes, followed by 35 cycles of denaturation at 95o C for 30 seconds, annealing 60o C for 1 minute, extension 72o C for 1.5 minute. A final extension step was performed at 72o C for 5 minutes. The PCR products were visualized on an 1% agarose gel in TAE buffer. The expected size of the amplicon was 1626 bp.
The gel band that appeared at 1626 bp was excised and the DNA fragment was purified using the MACHEREY-NAGEL PCR NucleoSpin Gel and PCR Clean‑up, following manufacturers’ instructions. The DNA fragment was eluded in 30 μl of warm ellusion buffer. Transformation of E. coli with pET 29c + vector.
Colonies that grew on LB+kanamycin plates (30 μg per mL)