General experiments / Toolbox


Heat-shock transformation for E. coli cells

Thaw the competent DH5a/BL21 cells on ice for 15 min. Add 1 ul of desired plasmid, for example, purified pEAS001 (mScarlet), into the tube. Incubate the cells on ice for 30 min. Heat-shock the cells in a 42°C water bath for 45 seconds and keep on ice for 5 min. Add 500 ul of LB into the tube. Place the culture on 37°C, 200-250 rpm for 1 hour. Plate 100 ul from the tube on an LBA plate containing desired antibiotic and the remaining 400 ul on a second plate. The volumes can be varied depending on the cell culture’s growth. Incubate at 37°C.


PCR

PCR reactions were conducted with Q5 High-Fidelity 2 X MasterMix (NewEngland BioLabs, United States) (NewEngland BioLabs, n.d.) according to the manufacturer’s protocol. This protocol was varied to suit our needs by testing different temperatures, times and cycles.


Table 1. PCR reaction conditions.
1. Initial Denaturation 98°C 30 s
2. 25-35 cycles 98°C
50-72°C
72°C
5-10 s
10-30 s
20-30 s/kb
3. Final Extension 72°C 2 min
4. Hold 4°C ∞
Table 2. Primers used in reporter gene amplifications and colony PCRs.
Primers Sequence Tm (°C)
lacZ forward GGTCTCTAATGACCATGATTACGGATTCACTGGCC 59.46
lacZ reverse GGTCTCTAACCTTATTTTTGACACCAGACCAACTGGTAATGG 58.81
mScarlet forward GGTCTCTAATGGTTAGCAAGGGTGAGGCAGTG 59.28
mScarlet reverse GGTCTCTAAGCTCACTTATAAAGCTCGTCCATGCCG 59.62
mScarlet-i forward GGTCTCTAATGGTTAGCAAGGGTGAGGCAGTG 59.28
mScarlet-i reverse GGTCTCTAAGCTCACTTATAAAGCTCGTCCATGCCG 59.62

Preparation of plates

Melt 100 ml of LBA. Add 100 µl of the desired antibiotic (either kanamycin 50 mg/ml, ampicillin 100 mg/ml or tetracycline 10-15 mg/ml) to the melted LBA. Mix and pour onto the plates. Leave to solidify. Apply parafilm and store the plates in a refrigerator at +4°C.


Preparation of growth media

Prepare the growth media according to the tables and autoclave them.

Table 3. 2 x YT per 1 liter
Tryptone 16 g
Yeast extract 10 g
Sodium chloride 5 g
Table 4. 4 x YTP+P per 1 liter
Tryptone 16 g
Yeast extract 10 g
Sodium chloride 5 g
Potassium phosphate monobasic 3.99 g
Potassium phosphate dibasic 6.97 g

Competent cells

Day 1)

Inoculate the cells in 5 ml of LB and grow overnight.

Day 2)

From the overnight culture, 0.1 - 0.5 % inoculate into 100 ml of LB and grow the cells to OD600= ~0.4-0.5. Incubate the culture at 4°C for 30 minutes. Centrifuge the cells at 5000rpm for 5 mins at 4°C in 50-ml Falcon tubes. Discard the supernatant and suspend the cells in each tube in 25 ml (or 50% of the original volume) of ice-cold sterile 0.1M MgCl2. Incubate on ice for 15 mins. Centrifuge the cells at 5000rpm at 4°C for 5 mins. Discard the supernatant and resuspend them in 25 ml of ice-cold sterile 0.1M CaCl2 and incubate in ice for 15 mins. Centrifuge the cells again (5000rpm for 5 mins at 4°C) and discard the supernatant. Resuspend the cells in each tube in 1 ml of ice-cold sterile 0.1M CaCl2 supplemented with 15-20% glycerol and aliquote 100 µl into each 1.5 ml tube. Store immediately at -80°C.


Plasmid extraction

Plasmid extraction was conducted with the Monarch® Plasmid Miniprep Kit (New England Biolabs, United States) according to the manufacturer’s protocol.


Digestion

Plasmids, for example ZikaV Sensor and ZikaV Trigger, were digested according to the following protocol. EcoRI HF was used for ZikaV Sensor and AvrII was used for Zika V Trigger.

Table 5. Digestion reaction.
Reaction component Concentration in the reaction
DNA 1 µg
rCutSmart 1 X
Restriction enzyme 1 U
H2O Up to reaction volume

Agarose gel electrophoresis

Prepare 1 % agarose gel by dissolving 0.60 g of agarose into 60 ml of 1 x TAE Buffer in the microwave and adding 6 µl of SYBR Safe (Thermofisher, United States) into the mixture. Pour the gel onto the gel tray and let it solidify.


Gel extraction

Gel extraction was conducted with the Monarch® DNA Gel Extraction Kit (New England Biolabs, United States) according to the manufacturer’s protocol.


Liquid cultures

Kanamycin (50 µg/ml) was used for toehold plasmids B69, B46 and B39, reporter plasmids pEAS001 and pEAS002 and for the control plasmid, ZikaV-Sensor. Ampicillin (100 µg/ml) was used for the reporter plasmid pET15b-LacZ, the control plasmid ZikaV-Trigger and the autolysis plasmid pAD-LyseR. Tetracycline (10 µg/ml) was used for BL21-Gold-deLac.

To prepare minipreps for strains containing desired plasmids, pick a single colony from a plate and inoculate it in 5 ml of 2xYT and desired antibiotic. Grow overnight at 200-250 rpm at 37°C.



Lysate production


Lysates provide the protein synthesis machinery necessary for the transcription of the toehold switches and the translation of reporter genes that become activated when the toehold switch recognizes its trigger sequence. In our project, we compared the effect of two distinct cell lysis methods, the sonication and the crude cell preparation autolysis, on the performance of the cell-free detection system. Autolysis is an innovative method described by Didovyk et al. (2017), in which the cell kills itself to produce the cell lysate. For autolysis, you only need to transform the autolysis plasmid into the desired cell strain and freeze the cells at -80°C to induce cell death. Lysis by sonication is based on sound waves that create cell membrane disrupting bubbles (ThermoFisher Scientific, n.d.) . The comparison gives us the opportunity to make our system as effective and optimal as possible. In addition, by using these approaches, our system will have more impact as an easy and affordable detection system as we can diminish the costs by using easier and cheaper production methods.


Autolysis by freeze-thawing

This autolysis protocol is based on work by Didovyk, Tonooka, Tsimring & Hasty, 2017.

Materials needed:

- LB plates supplemented with antibiotics

- LB/2xYT media supplemented with antibiotics

- 2xYTPG media supplemented with antibiotics

- S30A buffer: 50 mM Tris-HCl (pH 7.7), 60 mM potassium glutamate, 14 mM magnesium glutamate. Final pH adjusted to 7.7

- S30A+DTT: S30A supplemented with 2mM DTT

- E. Coli BL21-Gold-dLac

- 1 L flask


Growing and harvesting cells

Grow the cells with autolysis plasmid overnight on LBA + ampicillin plates at 37℃. Start the starter cultures by picking single colonies from the plates and growing them overnight at 37℃ in 4 ml of 2xYT+ampicillin medium. Start the production cultures by inoculating 400 µl of starter culture in 400 ml of 2 x YTPG + ampicillin medium and growing the cultures at 37℃ on a shaker (300 rpm) in a 1 L flask until optical density (OD600: 600 nm wavelength, 1 cm path) was reached. Harvest the cells by centrifugation for 15 mins, 1800 g at room temperature, when the 5-fold culture dilution had OD600 of 0.3.

Discard the supernatant and resuspend the pellet in circa 45 ml of cold (4-10℃) S30A buffer by vortex mixing. Transfer the resuspension to a pre-weighed 50 ml tube and centrifuge as earlier (15 min, 18000 g). Remove the supernatant and weigh the pellet. Resuspend the pellet in two volumes (pellet to buffer ratio 1:2) of cold S30A+DTT. For example, 2.6 ml of buffer was added to 1.3 g pellet.

A direct quote containing a note from the work by Didovyk et al, 2017: “Optimization: the quality and quantity of autolysate are sensitive to the pellet to buffer ratio; more concentrated autolysates usually have higher transcription-translation activity, however high concentration of cells leads to high viscosity of the solution after lysis and the lysate becomes difficult to clean of debris. The ratio can be optimized within the range of 1:1.8 - 1:2.5.”

Vortex and freeze the mix in -80℃ for 15 minutes.

A direct quote containing a note from the work by Didovyk et al, 2017: “Freezing cells in liquid nitrogen could potentially increase the quality.”


Freeze-thawing autolysates

Thaw the frozen cell suspensions in a water bath at room temperature and vortex vigorously for 2-3 min and incubate at 37℃ on a shaker at 300 rpm for 45 min. Vortex the mix one more time and incubate as above (45 min, 37℃, 300 rpm).

Note: Reducing the duration of runoff reaction (thawing), now 90 minutes, could potentially improve the performance when using E. Coli B strain.

Clear the sample by centrifugation for 45-60 min at 30 000 g at 4℃.

Note: Optionally longer centrifugation at 21 000 g, however higher speed helps to compact the sample.

Pipette the supernatant out carefully and centrifuge briefly (3-5 min, 21 000 g).

Optional step: The last centrifugation step can be repeated if the lysate is not largely free of cell debris.

Split the lysate into small aliquots, for example 50 µl or 100 µl, in Eppendorf tubes and freeze at -80℃ or use for cell or used for cell-free expression directly.


Sonication

Materials needed for sonication:

- Ice

- Cells on ice

- 200 ml plastic decanter tube (might be available at the sonication place)


Table 6. Sonication cycle.
1. Sonication 30 s
2. Rest 30-40 s
4 x Cycle

Maintain the cells on ice all the time. Remember to submerge the sonicator tip well but make sure that it doesn’t touch the tube anywhere. Please use hearing protection when running the machine.

We used Soniprep150 (MSE, the USA) for sonication.



The PURE system


The PURE system is a cell-free protein expression system that is constructed from individual components of protein synthesis, such as polymerases and ribosomes. It consists of four subsystems: transcription, aminoacylation, translation and energy regeneration. (Matsubayashi & Ueda, 2014) Like lysates, it provides the necessary protein synthesis machinery for the transcription of the toehold switches and the translation of activated reporter genes.

PURE Protein Synthesis was conducted with PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs) according to the manufacturer’s protocol, except we did not use the RNAse inhibitor. Instead, phenol-chloroform extraction was used to purify plasmid preps and to avoid RNA degradation.


Phenol-chloroform extraction (1:1)

Phenol-chloroform extraction

Add 1 x phenol:chloroform (V = 1:1) solution to the sample. Mix gently for 5 minutes by turning the tube a few times (do not vortex). Centrifuge for 5 minutes at 12 000 x g and transfer the top phase into a new tube for chloroform extraction.

Add 1 x chloroform extraction (V = 1:1) solution to the sample. Mix gently for 5 minutes by turning the tube a few times (do not vortex). Centrifuge for 5 minutes at 12 000 x g and transfer the top phase into a new tube for chloroform extraction.


Precipitating DNA

Add 2.5 x final volume of cold absolute ethanol, let precipitate in -80℃ for 1-2 hours. Alternatively precipitate the DNA at room temperature by adding Na-Ac (pH 5.0-5.3), 0.1 x of final volume and 2.5 x final volume absolute ethanol.

Collect the precipitate by centrifuging at 14 000 x g at 4°C for 10 min. Wash the precipitate by adding 1 ml of cold 70 % ethanol, vortexing and centrifuging as above. Remove the wash solution, spin the tubes and remove the rest of the wash solution by pipetting. Let the tubes dry with caps open.

Dilute the precipitation in 25 µl of MQ water, TE buffer or Tris buffer (1-10 mM TrisHCl pH 8).



Golden Gate assembly of toehold switches and sensors


Golden Gate assembly is a fast single-pot cloning method that enables the digestion and the subsequent ligation of multiple inserts simultaneously and isothermally. This is enabled by the clever design of cleavage sites and the use of IIS restriction enzymes. (Siddiqui, Sharma & Yazdani 2022) You can read more about Golden Gate assembly on Dry lab webpage. With the Golden Gate assembly, we were able to assemble our toehold switches and sensors fast and reliably.



Golden Gate Assembly of the toehold switch and trigger plasmids

Golden Gate Assembly was conducted with NEBridge® Golden Gate Assembly Kit (BsaI-HF® v2) (New England BioLabs) according to the manufacturer’s protocol.



Cell-free reaction and absorbance/fluorescence assay


Cell-free systems provide the necessary transcriptional and translational machinery for production without living cells that can spread and mutate. Cell lysates and the PURE system, a mix reconstituted from purified E. coli components, provide the necessary proteins and ribosomes for protein translation. (Garenne et al., 2021) In our cell free reactions, we combine either lysate or the PURE system, energy mix, amino acid mix, buffers, our trigger RNA and DNA containing the reporter gene.

Absorbance and fluorescence assays are where our reporter genes, mScarlet, mScarlet-i and lacZ come into play. If the toehold switch recognizes its trigger sequence obtained from BYDV, the detection system produces either fluorescence or a color detectable either with our plate reader or with our eyes.


RNA synthesis of the trigger sequence

Thaw the necessary kit components, mix and pulse-spin in microfuge to collect solutions to the bottom of tubes. Keep on ice. Add the reagents in the following order to the reaction tube: MQ water up to 20 µl, 1.5 µl 10 X RNAP reaction buffer (NEB); 1.5 µl each of the NTPs: ATP (100 mM), GTP (100 mM), CTP (100 mM), UTP (100 mM); 1 µg of linearized DNA and 1.5 µl T7 RNAP (NEB). 20 µl reaction. Incubate the reaction at 37°C for 4-16 hours. This protocol was modified from the Protocol for Standard RNA Synthesis by NEB.


Table 7. RNA synthesis reaction.
Reagent Stock concentration Concentration in the reaction (V = 20 µl)
10 X RNAP reaction buffer 10 X 1 X
ATP 100 mM 7.5 mM
GTP 100 mM 7.5 mM
CTP 100 mM 7.5 mM
UTP 100 mM 7.5 mM
Linearised template DNA - 1 µg
T7 RNAP 50 000 U/ml 75 U

RNA purification

RNA purification was conducted with the Monarch® Total RNA Miniprep Kit (New England Biolabs, United States) according to the manufacturer’s protocol.


Reagents for cell-free reaction


Table 8. Energy mix.
Components Stock concentration Concentration in the energy mix
HEPES 2 M 0.51 M
ATP + GTP 75 nM / 56 nM 15.11 nM / 11.28 nM
GTP 100 nM 3.71 nM
CTP 100 nM 9.00 nM
UTP 100 nM 9.00 nM
tRNA 50 mg/ml 2.00 nM
CoA 65 mM 2.60 mM
NAD 175 mM 2.02 mM
Folinic acid 33.9 M 0.68 M
Spermidine 1 M 0.01 M
Maltodextrin 650 mg/ml 121.64 mg/ml
Table 9. Amino acid mix.
Component Concentration in the reaction
Leucine 5 mM
Alanine, arginine, asparagine, aspartic acid, glutamine, glutamic acid, glycine, histidine, isoleucine, lysine, methionine, phenylalanine, proline, serine, threonine, valine, tryptophan, tyrosine, cysteine 6 mM

Cell-free reaction


Table 10. Cell-free reaction MasterMix. These concentrations depend on previous steps, such as plasmid or RNA purification, and need to be calculated separately each time.
Component Concentration in the reaction Volume (µl), V = 10 µl
Amino Acid mix (X) 1 2
HMP (mg/ml) 0.6 0.2
K-G (µM) 56 0.16
Mg-G (µM) 1.48 0.148
ONPG (mM) 0.3 1
PEG (%) 2 0.5
DTT (1 M) - 0.129
Cell extract (mg/ml) 10 2.44
DNA (nM) 3 3.85
Trigger RNA (nM) 500 1.23

Make three cell-free reaction samples with at least three replicates: 1) one water control without the toehold switch plasmid nor the trigger sequence, 2) one negative control without the trigger sequence and 3) one with both the toehold switch plasmid and the trigger sequence. You can prepare a MasterMix for each sample (Table 10). When preparing samples 1) and 2), add MQ-water instead of DNA and/or trigger RNA.

Load a desired volume, for example 5-20 µl, to a plate. You can also test different volumes for the same sample in the same run. We used a clear V-bottom 96-plate. Incubate the reaction at a desired temperature for a desired amount of time. We used various temperatures and times. 37°C and three hours worked the best for us.

Note: The concentrations of the reagents and the parameters of the run should be optimized to suit your needs. The concentrations and parameters we used might not work for you in the best possible way.



References


  • Didovyk, A., Tonooka, T., Tsimring, L., & Hasty, J. (2017). Rapid and Scalable Preparation of Bacterial Lysates for Cell-Free Gene Expression. ACS synthetic biology, 6(12), 2198–2208. https://doi.org/10.1021/acssynbio.7b00253

  • Garenne, D., Haines, M.C., Romantseva, E. F.,Freemont, P., Strychalski, E.A. & Noireaux, V. (2021). Cell-free gene expression. Nat Rev Methods Primers 1, 49. https://doi.org/10.1038/s43586-021-00046-x

  • Matsubayashi, H., & Ueda, T. (2014). Purified cell-free systems as standard parts for synthetic biology. Current opinion in chemical biology, 22, 158–162. https://doi.org/10.1016/j.cbpa.2014.09.031

  • NewEngland Biolabs. (n.d.) NEBridge® Golden Gate Assembly Kit (BsaI-HF® v2). Retrieved October 1, 2022 from https://www.neb.com/products/e1601-nebridge-golden-gate-assembly-mix-basai-hf-v2

  • NewEngland Biolabs. (n.d.) Protocol for Q5® High-Fidelity 2X Master Mix. Retrieved October 1, 2022 from https://international.neb.com/protocols/2012/12/07/protocol-for-q5-high-fidelity-2x-master-mix-m0492

  • New England BioLabs. (n.d.) Protocol for Standard RNA Synthesis. Retrieved October 7, 2022 from https://international.neb.com/protocols/2015/03/09/protocol-for-standard-rna-synthesis

  • Siddiqui, M. A., Sharma, A. & Yazdani, S. S. (2022) Design, building, and challenges in synthetic genomics. In Singh, V (Ed.), New frontiers and applications of synthetic biology (Singh, Ed.), (pp. 71). Academic Press.

  • ThermoFisher Scientific. (n.d.) Traditional Methods of Cell Lysis for Protein Extraction. Retrieved October 1, 2022 from https://www.thermofisher.com/fi/en/home/life-science/protein-biology/protein-biology-learning-center/protein-biology-resource-library/pierce-protein-methods/traditional-methods-cell-lysis.html#:~:text=Sonication%20of%20cells%20is%20the,spores%2C%20and%20finely%20diced%20tissue.