Protocols

1  LB Liquid Culture Medium

Materials for 1 L:

Yeast extract: 5 g

Tryptone: 10 g

NaCl: 10 g

 

Steps:

1)  Measure 10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl. Place them in a sterilized bottle with the maximum capacity of 1000 ml.

2)  Add 0.5 L of deionized water, shake the bottle until the solids completely dissolve. Then, add more deionized water until the solution has a volume of 1 L.

3)  Place the bottles into the autoclave for sterilization, under 121°C for 30 min.

4)  Let the bottles cool down under room temperature. The solution would preserve under room temperature for a maximum of 7 days.

 

2  LB Solid Culture Medium

Materials for 100 ml:

Agarose:1.5 g

LB Liquid Culture Medium:100 ml

100 μg/ml Ampicillin

50 μg/ml Kanamycin

 

Steps:

1)  Prepare the LB liquid medium according to the LB liquid medium formula. Before autoclaving, add 100 mL LB liquid medium into a 500 mL flask and add 1.5 g agarose at the same time.

2)  After autoclaving, put on gloves and take out the culture medium, shake the container to mix agarose thoroughly (the temperature of the culture medium is very high at this time, be careful of burns).

3)  When the culture medium is cooled to 50~ 60℃, add corresponding amount of  antibiotics, shake the container and mix well.

4)  Pave a plate (60 mm petri dish).

5)  Shelf life: 30 days

 

3  Practice Experiment on the Use of Polymerase Chain Reaction (PCR) 

Materials for Experiment:

ddH2O:29.5 μl (9.5 μl×3 + 1 )

Green Taq Mix: 37.5 μl (12.5 μl×3)

Primer1 (10 μM): 3 μl

Primer2 (10 μM): 3 μl

cDNA: 2 μl

 

Steps:

1)  Prepare 29.5 μl of ddH2O, 37.5 μl of Green Tag Mix, 3 μl of forward primer, 3 μl of reverse primer, and 2 μl of cDNA.

2)  Label 3 Eppendorf tubes from 1 to 3, in this case, Eppendorf tube 1 is considered as positive reference and Eppendorf tube 3 as negative reference, in the meantime, Eppendorf tube 2 is regarded as coding sequence needed to be amplified.

3)  Add 12.5 μl of Green Taq Mix into Eppendorf tube 1, 2, and 3 via pipette tips. Add 1 μl of primer 1 and 1 μl of primer 2 into Eppendorf tube 1, 2, and 3 by the same means.

4)  Add 1μl of cDNA into Eppendorf tube 1 and 2. Meanwhile, add 1μl of ddH2O into Eppendorf tube 3.

5)  Add 9.5μl of ddH2O into Eppendorf tube 1, 2 and 3.

6)  Protocol of Colony PCR: Preheating at 95 ℃ for 3 min; Replicating the following steps for 34 times: heating at 95 ℃ for 15 s, annealing at 60 ℃ for 15 s, extending at 72 ℃ for 60 s (at a speed of about 1 kbp/min); extending at 72 ℃ for 5 min; Store the products at 12 ℃.

 

4 DNA Electrophoresis

Materials:

Agarose: 1 g

TAE: 1000 ml, should be made in advance, either by dissolving TAE solid particles in proper amount of water or use existing liquid TAE solution.

DNA markers: 5μl for a well

Loading buffer: 1μl for a well

Step:

1)  Add 1 g agarose into 100 ml 1×TAE.

2)  Heat the solution until it is transparent.

3)  Cool it down to room temperature and add 5 μl Gelred, pour it into a mold.

4)  Move the gel plate into an electrophoresis tank and soak it in the buffer (1×TAE).

5)  Set the baffle plate and comb in the tank, and seal the baffle inside, until the gel is cooled to 50˚C.

6)  Remove the baffle and vertically pull out the comb.  

7)  Add 5μl DNA testing sample with 1μl loading buffer. Blow and homogenize the solution.

8)  Add the above solution and 5μl DNA marker solution to each gel well, respectively. Immediately start the electrophoresis with a voltage of 110V for 30 min.

 

5 Plasmid Extraction

Materials:

3ml E.coli bacteria liquid

250 μl RB

250 μl LB

350 μl NB

500 μl TB Buffer

700 μl DNA Wash Buffer

30-50 μl Elution Buffer (10 mM Tris-HCl, pH 8.5) or sterile water to the column matrix

Steps:

1)  Collect 3 ml bacteria liquid after incubating overnight, centrifuge at 10000 × g at room temperature and discard the medium.

2)  Add 250 μl RB (with RNase A), and completely suspend cells by vortex oscillation.

3)  Add 250 μl LB to the resuspended mixture and invert it gently for 4-6 times. This reaction should not exceed 5 min.

4)  Add 350 μl NB and reverse it several times until white flocculent precipitation was formed.

5)  Centrifuge at 10000 × g at room temperature for 10 min.

6)  Transfer the supernatant to a HiBind DNA binding column with 2 ml collection tube. Centrifuge at 10000 × g for 1 min at room temperature. Drain the filtrate from the pipe.

7)  Put the column back into the collection tube, add 500 μl TB Buffer, centrifuge at 10000 × g for 1 min at room temperature, discard the filtrate.

8)  Put the column back into the collection tube, add 700 μl DNA Wash Buffer, centrifuge at 10000×g for 1 min at the room temperature, discard the filtrate. Note: The concentrated DNA Wash Buffer must be diluted with anhydrous ethanol prior to use, as indicated on the label.

9)  (optional) to achieve a better washing effect, repeat step 8 once and discard the filtrate again.

10)  Reinstall the column into the collection tube. Centrifuge the empty column at 10000×g for 2 min to dry the column matrix.

11)  Mount the column on a clean 1.5 ml centrifuge tube and add 30-50 μl Elution Buffer (10 mM Tris-HCl, pH 8.5) or sterile water to the column matrix. Let it stand for 1-2 min and then Elution out the DNA by centrifugation at 10000 × g for 1 min. The concentration and purity of the plasmids were determined by Nanodrop 2000.

 

6 The transcription of igRNA in a cell-free TXTL system

Materials:

LS70 master mix (produced by Vazyme, China):9 μl

RNA polymers: 1 μl

Plasmid: pET-28 plasmid synthesized by Tsingke Technology, China.

10 mM IPTG: 1 μl

nuclease-free water: 20 μl

Steps:

1) Add 9 μl LS70 master mix into a collection tube, and make sure it is on the bottom.

2) Add 1 μl plasmid.

3) Add 1 μl of 10 mM IPTG.

4) Add 1 μl plasmid.

5) Keep the reaction at 37℃ for 16 hours.

 

7 PCR for one step cloning

 

Materials needed for one tube:

1 μl forward primer

1 μl reverse primer

29.5 μl free-nuclease water

25 μl Green Taq Mix

1 μl template of DNA

Steps:

1)  The forward and reverse primer sequences of each plasmid DNA used in this experiment are presented in Table 1. The primers are synthesized by Youkang Company, China.

2)  Add 8 μl free-nuclease water into an Eppendorf tube, and add 1 μl forward primer and 1 μl reverse primer into the tube. This process dilutes the mixture to one tenth of previous concentration.

3)  Blow and homogenize the mixture, and then transfer 2.5 μl mixture to another Eppendorf tube.

4)  Add 25 μl Green Taq Mix, 1 μl template of DNA and 21.5 μl nuclease-free water into the new Eppendorf tube. Blow and homogenize it. Preserve it on ice before starting the PCR reaction.

5)  PCR protocol:

Preheat to 95℃ for 3 min. Then repeat the following cycles for 35 times:

1. Denature at 95℃ for 15 sec.

2. Anneal at Tm value for 15 sec (Refer to Table 1 for Tm value for different primers used. Primers with similar Tm value (less than 5℃ in difference) can be operated together, and the reaction is set at the highest Tm value of the primers in the system).

3. Extend at 72℃ for about 5.5 min (Time can be set by following the pattern of 1 kbp/min.)

After finishing the cycles, keep it at 72℃ for another 5.5 min, then conserve the product at 12℃.

 

8. Purification of DNA

Materials:

PCR products

NaAc (Sodium Acetate) solution

70% Ethanol

Anhydrous ethanol

Nuclease-free water

Steps:

1) Add 45 μl PCR product into an Eppendorf tube.

2) Add pre-cooled 4.5 μl of NaAc (Sodium Acetate) into the Eppendorf tube and 99 μl of anhydrous ethanol, incubate the Eppendorf tube on the ice or in the fridge of -30℃ for 30 minutes. (Na+ can combine with nucleic acid which is negative because of PO43- and forms Sodium salt; Anhydrous ethanol can absorb water to let salt separate out)

3) Centrifuge the product at 12000 × g at room temperature for 2 minutes.

4) Discard the supernatant. Remember to hold the Eppendorf tube in a 45 degree angle and remain the surface of sediment upward. Note that the top of transfer pipette is not supposed to touch the sediment to avoid taking sediment away.

5) Add pre-cooled 1000 μl 70% ethanol to the Eppendorf tube, then centrifuge again at 12000 × g at room temperature for 2 minutes. Discard the supernatant. Remain the cap of the Eppendorf tube open to let ethanol volatilize. (DNA is not soluble in 70% ethanol while salt ions can be washed away)

6) Add nuclease-free water to the test tube to dissolve the DNA. Blow and homogenize the mixture.

 

9. Using Dpn1 enzyme to cleave plasmids

Materials:

DNA product after purification: 8 μl

10×buffer: 1 μl

Dpn1 restriction enzyme: 1μl

Experiment principle: DpnI is a Type IIM restriction enzyme that specifically cleaves DNA containing methylated adenine (mA) in the recognition sequence GmA | TC [1]

Steps:

1) Add 8 μl DNA product after purification into an Eppendorf tube (the test tube). Before adding DNA, make sure the DNA is blown and homogenized in the Eppendorf tube.

2) Add Dpn1 restriction enzyme 1 U into the test tube. 1 U stands for the ability for a restriction enzyme to catalyze 1 μg enzyme in the 50 μl reaction system and 37℃ environment.

3) Add 10×buffer 1 μl into the test tube.

4) Incubate the product at 37℃ for about an hour.

 

10 Plasmid transformation

Materials for transformation of one plasmid:

TSC-C14 DH5a chemically competent cells from Tsingke Technology, China

10μl plasmid (plasmid constructed in this project and cleaved by Dpn1 enzyme is used in the test group; untreated plasmid of pET-28a synthesized by Tsingke Technology, China, is used in the positive control group; nuclease-free water is used instead for the negative control group)

700μl sterile LB solution

 

Steps:

The test group, positive control group and negative control group are set up for this experiment.

1) Thaw  100 μl of competent cells stored in the -80℃ fridge on ice, add it into an Eppendorf tube, and add 10μl of plasmid. The whole process should be carried out aseptically on ice. 

2) Homogenize the tube gently, and place it on ice for 30 min.

3) Heat shock the competent cells quickly in 42℃ hot water for 30-60 sec, take out the tube quickly and place it again on the ice. Wait for another 2 min, avoid shaking the tube to prevent reducuction in conversion efficiency in the process.

4) Make 700 μl sterile liquid medium (LB) without resistance in advance, and add it into the tube. Homogenize the cell suspension and recover it on the 37℃ shaker for 200 rounds per min for 60 min (1 hour).

 

11 Colony Screening

Materials needed:

Transformed competent cells 

LB solid culture medium with Kanamycin

Sterile glass beads or SS spreader

 

Steps:

1)  Take out the tube containing the transformed competent cells incubated in the shaker in the previous transformation experiment.

2)  Centrifuge it at 2000rpm for 10 sec and discard some supernate. Remain suited amount of liquid according to experimental needs. Blow and homogenize the cell suspension again.

3)  Heat and melt the solid LB medium containing Kanamycin, and add it to a sterile culture dish. Wait till the medium is cooled and solidified. Add the cell suspension to the dish, and use sterile glass beads or sterile SS spreader (Stainless steel spreader) to spread it uniformly.

4)  Place the dish invertedly in the 37°C incubator overnight.

5)  Send the colonies present to the laboratory to do Sanger gene sequencing (Chain termination method).

 

Table 1 The primer sequences we used to construct plasmids

 

Primers

Sequences

Tm/℃

CG ratio

1-1-F

GCTGGCATTGCCCTCCTCGAGCACCACCAC

70.57

66.67

1-1-R

GTGGTGGTGCTCGAGGAGGGCAATGCCAGC

70.57

66.67

1-2-F

CTGGCATTGCCCTCCTCGAGCACCACCA

68.40

64.29

1-2-R

TGGTGGTGCTCGAGGAGGGCAATGCCAG

68.40

64.29

2-1-F

CTCTAGATAATTTCTACTAAGTGTAGATACGCTGGG

61.96

38.89

2-1-R

CCCAGCGTATCTACACTTAGTAGAAATTATCTAGAG

61.96

38.89

2-2-F

CCCCTCTAGATAATTTCTACTAAGTGTAGATACGCTGGGGCTGG

68.10

47.73

2-2-R

CCAGCCCCAGCGTATCTACACTTAGTAGAAATTATCTAGAGGGG

68.10

47.73

3-1-F

CCCTCTAGATAATTTCTACTAAGTGTAGATGTCCATTGAGC

63.70

39.02

3-1-R

GCTCAATGGACATCTACACTTAGTAGAAATTATCTAGAGGG

63.70

39.02

4-1-F

GTCCATTGAGCAAGCACTCACTAGACTGTCCTCGAGCACCACCACCACCACCA

73.67

56.60

4-1-R

GACAGTCTAGTGAGTGCTTGCTCAATGGACATCTACAAGAGTAGAAATTATCTAGAGGGG

69.33

43.33

5-1-F

CCCCTCTAGATAATTTCTACTCTTGTAGATCTTAAAGTTTCCCATGTCTCA

65.37

37.25

5-1-R

ATCTCAGTGGTGGTGGTGGTGGTGCTCGAGGGGAAAATCGCTGTGTTC

72.55

56.25

5-line-F

CTCGAGCACCACCACCAC

59.46

66.67

5-line-R

ATCTACAAGAGTAGAAATTATCTAGAG

53.53

29.63

Annotation: Primers are named as plasmid number-method-F/R; plasmid number :1-5 stand for plasmid 1-5; method: 1 for Transfer-PCR (T-PCR) method [4], line for homologous recombination method; F/R: F stand for forward primer, R stand for reverse primer.

 

 

Tm (The temperature of melting) value is defined as the temperature at which 50% of dsDNA is changed into ssDNA. The GC content of the sequence gives a fair indication of the primer’s Tm value, the formula will be Tm = 4(G + C) + 2(A + T)=°C [3]

 

In this experiment, we make some slight modifications to plasmids in order to compare the results of different way to construct igRNA. The sequences of different plasmids we designed and constructed are listed below.

 

Plasmid 0: Original plasmid: TAATTTCTACTCTTGTAGATACGCTGGGGCTGGCATTGCCCTCGAAACTTTAAGGAAAGAGGGCAATGCCAACAGCTGATTGTTTT

 

Plasmid 1: delete inactive sequence

TAATTTCTACTCTTGTAGATACGCTGGGGCTGGCATTGCCCTC

 

Plasmid 2: Change CT to AAG in the Cas12a handle)

TAATTTCTACTAAGTGTAGATACGCTGGGGCTGGCATTGCCCTCGAAACTTTAAGGAAAGAGGGCAATGCCAACAGCTGATTGTTTT

 

Plasmid 3: Change CT to AAG, and use a different guide sequence previously used by GreatBay_SZ, delete inactive sequence

TAATTTCTACTAAGTGTAGATGTCCATTGAGCAAGCACTCACTAGACTGTC

 

Plasmid 4: use a different guide sequence previously used by GreatBay_SZ and delete inactive sequence

TAATTTCTACTCTTGTAGATGTCCATTGAGCAAGCACTCACTAGACTGTC

 

Plasmid 5: Use hsa_circ_0001785 as the trigger sequence while hsa_circ_0001982 as the guide sequence

TAATTTCTACTCTTGTAGATCTTAAAGTTTCCCATGTCTCATAACTAAAGGCATTGTGAGACATGGGAACACAGCGATTTTCCC

 

 

Reference:

[1] https://www.takarabio.com/products/cloning/restriction-enzymes/dpni

[2] Contact information for EZassay corporation: info@ezassay.com

[3] https://www.labce.com/spg1025559_melting_temperature_tm.aspx

[4] Erijman, A., Dantes, A., Bernheim, R., Shifman, J. M., & Peleg, Y. (2011). Transfer-PCR (TPCR): a highway for DNA cloning and protein engineering. Journal of structural biology, 175(2), 171-177.