1. Project   goal

The purpose of our project is to help facilitate the screening and prognosis of breast cancer for ordinary people at home.   We developed a detection kit for two circRNA biomarkers, hsa_circ_0001785 and hsa_circ_0001982, of breast cancer. They are the target circRNAs for detection in this project.

The kit  is a cell - free system containing all molecular machineries needed for a CRISPR-Cas12a-based detection process. T he CRISPR-Cas12a system mainly consists igRNA, Cas12a enzyme, dsDNA and a reporter DNA (fluorescence probe).

In this project, w e have successfully constructed 8 composite parts and 10 basic parts for igRNA s  and dsDNA s  (Table 1).

In this project, we have successfully constructed 8 composite parts and 10 basic parts for igRNAs and dsDNAs. Please refer to our Parts page for details.

2. Biomaterials Introduction

2.1. Plasmid – pET28a

The plasmid pET28a is selected as the expression vector for igRNAs in our project. Plasmid pET28a contains T7 promoter and restriction enzyme cutting sites, XbaI and XhoI. These elements play important roles in reconstructing and optimizing plasmid. XbaI and XhoI are used when changing certain sequences. T7 polymerase is vital in expressing igRNA in a cell-free system.

2.2. Host – E. coli  DH5

E s cherichia coli (E. coli) DH5  is commonly used as bio-carrier in synthetic biology. It has got the trait of lacking specific immune reaction towards exogenous DNA (or plasmid), so we select DH5  for storage and construction of recombined plasmids.

3. Experimental Design

Our goal of this project is to design a method for the early diagnosis and prognosis of breast cancer through using Cas12a – igRNA – circRNA system in vitro.

3.1. The cell-free system

In our experiment, cell-free simply means “reaction outside the cell”: all of the reaction parts take place in a 1.5mL microcentrifuge tube, with a total volume of 20 . Except igRNA, all of our elements, including fluorescence probe and cas12a protein, come from an existing commercial test kit. igRNA is expressed in vitro  by adding 1  constructed plasmid, 1  p70 polymerase, 1  inducer ( -galactoside, inducer of lac operon), and 9  LS70 (Fig.1).

Fig.1 Gene tic circuit for igRNA expression in our cell-free system

3.2. Design of the detection device

The principle of our hardware design is based on the property of Cas12a-igRNA fluorescence detection system. The system gives fluorescence signals observable under UV light. Our detection device contains a UV lamp in a closed box. The reaction system can be put in the box and the results can be observed in the most convenient and safest way. The device is consisted of a box, a sliding s helf holding eight-strip tubes, a UV light source, and a viewing window.

3.3. Biobricks

Fig. 2 Schematic graph of experiment design and principle

- Repressor system

crRNA is complementary to target DNA and can allow Cas protein to cut the DNA by recognizing special PAM sites on the DNA (for Cas12a protein, it is TTTV). However, our target sequence is circRNA, which cannot be recognized directly by Cas12a protein. To address this problem, we designed an RNA-interacting guide RNA (igRNA) and expressed it in vitro , as mentioned above. igRNA can bind with trigger RNA, which changes the designed hairpin repression structure of guide sequence. The unrepressed guide can bind to dsDNA, thus activating Cas12a enzyme. The activated Cas12a enzyme hence cuts the reporter DNA (fluorescence probe) in the system. The trigger RNA is a unique sequence of the target circRNA in our project. So our target circRNAs serve as RNA triggers. Once the circRNA is present, it binds to the repression part of designed hairpin, thus releasing guide sequence.

We first designed our igRNA based on the sequence of one RNA trigger, hsc_circ_0001982. The sequences of inactive parts of igRNA, which is called VR1 and VR2, were designed to be anti-complementary of selected circRNA sequences and is located on the 3’ side, while the Cas12a recognition sequence is located on 5’ side. These specific sequences were chosen to be the two sides of the fusion segment of the circRNA, which is highly specific to one typical circRNA (for hsc_circ_0001982, sequence of fusion segment is 5’-GG-3’). We selected 15bp at the starting and ending points of hsc_circ_0001982 to be VR1 sequence and VR2 sequence, respectively, and put them together based on the formation principle of circRNA, which is back-splicing. As a result, the chosen circRNA sequence is unique and specific to the circRNA.

Between VR1 and VR2, there is a designed sequence that is partly anti-complementary to guide sequence (5’-GAGGGCAATGCCA-3’) (which is complementary to dsDNA substrate GAPDH; its sequence will be 5’-ACGCTGGGGCTGGCATTGCCCTC-3’). The guide sequence is located on the 5’ side of igRNA. Since the guide sequence is repressed by its  designed complementary strand, it cannot serve the function of l eading Cas12a protein to cut dsDNA substrate.

So, the overall igRNA sequence based on hsc_circ_0001982 is: 5’- TAATTTCTACTCTTGTAGAT/ACGCTGGGGCTGGCATTGCCCTC/GAAACTTTAAGGAAA/GAGGGCAATGCCA/ACAGCTGATTGTTTT-3’.

- R ecognition system

As shown in Fig . 2B, when trigger RNA is present, VR1 and VR2 sequences of igRNA bind to the relative sequences on circRNA in an inverse-complement form. Once they are successfully combined, the repressed guide sequence is released and binds to the dsDNA, allowing Cas12a protein to efficiently and specifically cut dsDNA substrate (we used GAPDH) and ssDNA including the reporter DNA. Therefore, the reporting system is activated.

- R eporting system

As shown in Fig. 2C, when circRNA is present, Cas12a protein can be activated so that the related dsDNA substrate which contains the PAM site (TTTV) is recognized and cut. In this case, Cas12a protein is in secondary activation stage so that it can cut ssDNA including the fluorescence probe in the system as well.

One end of the fluorescence probe is a quencher dye and the other end is FAM (a gene for a fluorescence dye). When the probe is complete, the fluorescence signal is absorbed by the quencher; after Cas12a protein is secondarily activated, this ssDNA probe is cut so that the fluorescence dye expressed by FAM emits fluorescence signal naturally, showing our target is present.

To sum up, the overall structure of our system is: target circRNA activates igRNA; igRNA activates Cas12a protein; dsDNA substrate put Cas12a protein in secondary activation stage; ssDNA is cut; and finally the fluorescence signal appears.

Fig.3 The cell-free expression of igRNA and the activation of the CRISPR-Cas12a system

4. Optimization design

In this part, our goal is to firstly, redo the experiments done by previous teams; secondly, to compare which part creates higher efficiency and sensitiveness of the overall CRISPR-Cas12a detection system.

4.1. Optimization of the concentration of elements in the system

In this part, our goal is to find out the best-fit volume of each element, including ssDNA probe, dsDNA substrate, Cas12a protein, trigger RNA, and igRNA, that can be used in the system to maximize the efficiency and sensitiveness of the system.

The dsDNA used was GAPDH dsDNA, trigger RNA is hsc_circ_0001982, igRNA contained an inactive part recognizing hsc_circ_0001982, and a guide recognizing GAPDH dsDNA. Here are our experiments and results:

- Cas12a  protein

The total volume of the system is 20 . The recommended volume use of Cas12a protein is 1 . Here are the concentrations we tried: 0. 2  0.5 1 2 5 .

The results showed that the system containing 5  protein of concentration 10 M generated the brightest fluorescence signal, as shown in Fig. 4.

Fig. 4 Fluo rescence results of CRISPR-Cas12a systems containing 0.2 0.5 1 2 and 5  Cas12a protein (10 M) (from left to right: 0.2 0.5 1 2  5  negative control)

- igRNA & trigger RNA

We tested the best-fit concentration of igRNA and trigger RNA. Here are the concentrations we tried for igRNA: 0. 1 0.5 1 2 5 .

The result showed that the system containing 5  igRNA generated the brightest fluorescence signal, as shown in Fig.5.

Fig. 5 Fluo rescence results of CRISPR-Cas12a systems containing 0. 1 0.5 12   and 5 igRNA (from right to left)

Here are the concentrations we tried for trigger RNA: 0. 1 0.5 1 2 5 . The result showed that the system containing 0.5  trigger RNA generated the brightest fluorescence signal, as shown in Fig.6.

Fig.6 Fluo rescence results of CRISPR-Cas12a systems containing 0. 1 0.5 12 5 trigger RNA [from left to right:1) 0.1 ,  2) 0.5  3) 1  4) 2  5) 5  6) irrelevant, 7) negative control]

- dsDNA substrate

The recommended volume use of dsDNA substrate is . Here are the concentrations we tried: 0. 5 1 .5 2.4 3.5 4 .5 .

The result showed that the system containing 4.5  dsDNA generated the brightest fluorescence signal, as shown in Fig. 7.

Fig. 7  Fluo rescence results of CRISPR-Cas12a systems containing 0. 5 1 .5 2.4 3.5 4 .5   dsDNA substrate [from left to right: 1) 0.5  2) 1.5  3) 2.4  4) 3.5  5) 4.5  6) negative control]

- ssDNA probe

When testing the best-fit volume of probe, we used the 10  system. The recommended volume use of ssDNA probe is 0.6 . However, during the course of the experiments, we found that this concentration was too high that there was light fluorescence signal appeared even in negative control, where either of these important elements was missed. So, we decided to dilute the probe to 1/10 of original concentration. Here are the original concentrations we tried: 0. 6 0. 3 0 . 1 .  We put 0.5  concentrate probe into 4.5  deionized water. Since the diluted system is 5 , 0.6  corresponds 3 , 0.3  corresponds 1.5 , and 0.1  corresponds 0.5 .

The result showed that the system containing 0.3  concentrate probe generated the brightest fluorescence signal, as shown in Fig. 8.

Fig.8 Fluo rescence results of CRISPR-Cas12a systems containing   0. 6 0. 3 0 . 1  ss DNA probe [from left to right:1) 0.6  2) 0.3  3) 0.1  4) negative control]

5. Rebuilding past iGEM team experiments

BBa_K2961003  from the iGEM19_CMUQ   team (also the BBa_K3859000 from the iGEM21_GreatBay_SZ team) contains a Cas12a handle region that can be used by us. W e changed three base pairs of this Cas12a handle sequence from AAG into CT, and obtained an original Cas12a handle, in the hope of improving the sensitivity for Cas12a enzyme.  BBa_K2961003   Cas 12 a  handle sequence: TAATTTCTACT AAG TGTAGAT; our original Cas12a handle sequence: TAATTTCTACT CT TGTAGAT.

5.1 Plasmid Reconstruction

We choose pET28a+ to be our vector plasmid and insert the sequence of our igRNA between its XbaI and Xho1 enzyme cutting sites. Our original igRNA sequence contains our original Cas12a handle, a guide sequence that recognizes GAPDH dsDNA, and an inactive part of the igRNA that can bind to the circRNA hsc_circ_0001982 .

- Delete inactive part

We designed two primers, 1-1 and 1-2, based on fragment cutoff method ( Fig.9 ) ,  using PCR to delete the inactive part. For 1-1, we picked 15bp of sequences in front of the inactive sequence and 15bp of sequences behind the inactive sequence. For 1-2, we picked 14bp of sequences in front and 14bp behind.  

1-1-F: GCTGGCATTGCCCTCctcgagcaccaccac

1-1-R: gtggtggtgctcgagGAGGGCAATGCCAGC

1-2-F: ctggcattgccctcctcgagcaccacca

1-2-R: tggtggtgctcgaggagggcaatgccag

Fig. 9 Plasmid reconstruction primer design (deletion of inactive part)

We combined 2  Forward and 2  Reverse primer together, and added 0.5  and 1  to the PCR mix respectively. We successfully constructed the plasmid without the inactive part by using 1-1 primer, as shown in Fig.10.

Fig. 10 Electrophoresis result of 1-1,1-2 primer PCR product (second to fifth lanes from left to right)

- Change CT to AAG (substitution of important sequence on the Cas12a handle)

We designed primers 2-1 and 2-2 based on site-specific mutagenesis (Fig. 11) to convert an important sequence on the Cas12a handle, CT, to AAG. The original template contains GAPDH behind the Cas12a handle.

2-1-F: ctctagaTAATTTCTACTAAGTGTAGATACGCTGGG

2-1-R: CCCAGCGTATCTACACTTAGTAGAAATTAtctagag

2-2-F: ccctctagaTAATTTCTACTAAGTGTAGATACGCTGGGGCTGG

2-2-R: CCAGCCCCAGCGTATCTACACTTAGTAGAAATTAtctagagggg

Fig.11 plasmid reconstruction primer design (substitution of CT to AAG)

We successfully reconstructed the plasmid using 2-2 primer with 1  of FR compound (Fig.12). After that, we used 2-2 primer to reconstruct the PCR product we got from the first step of plasmid reconstruction (deletion of inactive part), the result is shown below in Fig.13. As we can see in the middle two lanes of the image constructed, there are obvious bands which indicates the succeed of the second step of our plasmid reconstruction.

Fig.12 electrophoresis of PCR product using 2-2 primer(DNA template is the pET-28+ plasmid with our original igRNA sequence inserted)

Fig. 13 electrophoresis of PCR product using 2-2 primer(with DNA template constructed from the first step of plasmid reconstruction)

-Change GAPDH to BBa_K3859000 (guide)

We designed primer 2-3 and primer 4-1 to convert the dsDNA binding region from GAPDH to BBa_K3859000, a sequence that iGEM_21_GreatBay_SZ team used. Therefore, in order to change the sequence of dsDNA binding region, we chose a method called “short fragment insertion” and designed the primer based on it (Fig.14). 2-3 is designed for DNA template that has AAG as the important sequence on Cas12a handle (PCR product shown in Fig. 12 and Fig. 13). Primer 4-2 is designed for DNA template that utilized CT as the important sequence on Cas12a handle, instead of AAG(PCR product shown in the first four lanes of Fig.10).

2-3-F:

GTCCATTGAGCAAGCACTCACTAGACTGTCctcgagcaccaccaccaccaccactgagat

2-3-R:

GACAGTCTAGTGAGTGCTTGCTCAATGGACATCTACACTTAGTAGAAATTAtctagaggg

4-1-F: GTCCATTGAGCAAGCACTCACTAGACTGTCctcgagcaccaccaccaccacca

4-1-R: GACAGTCTAGTGAGTGCTTGCTCAATGGACATCTACAAGAGTAGAAATTAtctagaGGGG

Fig. 14 plasmid reconstruction primer design (replacement of GAPDH to BBa_K3859000)

We successfully reconstructed the plasmid utilizing these two primers with both 0.5  and 1.0  added, as shown in the image created after electrophoresis (Fig.15 and Fig.16).

Fig.15 Electrophoresis of PCR product using 2-3 primer, in the last two lanes of the gel (DNA template is the plasmid reconstructed using primer 2-1 or 2-2 from the plasmid contains our original sequence (2 in the graph)

Fig.16 Electrophoresis of PCR product using 4-1 primer, in the second and third lanes of the gel from right to left (DNA template is the original plasmid treated with primer 1-1 or 1-2)

- 1785 trigger 1982 guide

We designed primer 5-1 and 5-line to convert the original plasmid to a plasmid which contains 1785 inactive sequence that can bind to trigger RNA hsa_circ_0001785 , and 1982 dsDNA guide sequence to recognize the 1982 dsDNA based on the sequence of hsa_circ_0001 982. We applied the concept of homologous recombination. As a result, we designed primer 5-1 to add two homologous arms to the fragment we wanted to insert, and primer 5-line to linearize the vector plasmid. The 15-20 bp sequence at the end of the linearized vector was used as a homologous sequence (marked in red and blue in Fig.17) and added to the 5' end of the gene-specific forward/reverse amplification primer sequences, respectively, to amplify the insert with homologous sequences from the primer pairs. As shown in Figure 18, we successfully linearized the vector and added the homologous arms onto the fragment, constructing the plasmid for igRNA (1785 trigger 1982).

Fig.17 Principle of homologous recombination

5-1-F: cccctctagaTAATTTCTACTCTTGTAGATCTTAAAGTTTCCCATGTCTCA

5-1-R: atctcagtggtggtggtggtggtgctcgagGGGAAAATCGCTGTGTTC

5-line-F: ctcgagcaccaccaccac

5-line-R: ATCTACAAGAGTAGAAATTAtctagag

Fig.18 Electrophoresis of PCR product using 5-1 and 5-line primer  

As shown in the second and third lanes from left to right, there are two obvious bands created, which means we successfully reconstructed this plasmid targeting for 1785 trigger and 1982 guide.

By designing five primers, we accomplished the goal of reestablishing the plasmid used by iGEM_21_GreatBay_SZ and iGEM19_CMUQ.

The graph shown below (Fig.19) is a conclusion of the results of our plasmid reconstructions.

Fig. 19 Summary of all the plasmids we reconstructed

The red part represents the GAPDH guide recognition sequence (our original dsDNA recognition part); the blue characters are the sequence of BBa_K3859000(the reconstructed dsDNA recognition part); the yellow characters represent 1785 guide recognition sequence. The yellow highlighter marks the inactive sequence that needs trigger RNA to open. The green highlighter represents the 1982 trigger RNA binding site.

5.2 Comparison of the efficiency of different igRNA parts

We tested the efficiency of seven igRNAs after transcribing the plasmids in cell-free system. The serial number of the seven plasmids are:

Plasmid 1: PCR product with primer 1-1(CT, GAPDH as guide, without inactive part)

Plasmid 2i: PCR product with primer 2-2(AAG, GAPDH as guide, with inactive part for hsc_circ_0001982 as trigger )

Plasmid 2: PCR product with primer 1-1 and 2-2(AAG, GAPDH as guide, without inactive part)

Plasmid 3: PCR product with primer 2-2 and 2-3(AAG, BBa_K3859000 as guide, without inactive part)

Plasmid 4: PCR product with primer 1-1 and 4-1(CT, BBa_K3859000 as guide, without inactive part)

Plasmid 5: PCR product with primer 5-1 and 5-line (CT, hsc_circ_000 1982 as guide, with inactive part for hsc_circ_0001785 as trigger )  

Plasmid 6: The original template (CT, GAPDH as guide, with inactive part for hsc_circ_0001982 as trigger )

As shown in Fig. 19, every plasmid we constructed has their own serial number to facilitate our comparison and contrast. The results are shown below in Fig. 20.

Fig.20 Results of different igRNAs in CRISPR-Cas12a system under ultraviolet light [From left to right: 1) positive control (plasmid 6), 2) plasmid 2i, 3) plasmid 2, 4)plasmid 3, 5) plasmid 4, 6) plasmid 5, 7) plasmid 1, 8) negative control]

When we compared the intensity of fluorescent signal using imageJ, we found that plasmid 2 (AAG, GAPDH as guide, without inactive part) , with a relative intensity of 101.6, was a bit higher than plasmid 3 (AAG, BBa_K3859000 as guide, without inactive part) , with a fluorescent value of 101. This showed that our dsDNA GAPDH might be more efficient. By comparing plasmid 3 and 4 ( CT, BBa_K3859000 as guide, without inactive part ), we arrived at a conclusion that CT might be more effective than AAG since the relative fluorescent intensity of plasmid 4 was higher than that of plasmid 3.

Plasmid 6, our original plasmid with 1982 trigger and GAPDH guide, had the highest fluorescence intensity, indicating the combination of GAPDH guide and 1982 trigger worked really effectively together at activating the system. Plasmid 5, with 1785 trigger 1982, emitted less fluorescence and thus needed more experiment to verify its effectiveness, as shown in detail in “Functional Verification” part.

6. Functional verification

- Utilizing synthetic dsDNA and non-synthetic trigger RNA

In order to test the least concentration of the trigger RNA needed to activate the system, we designed an experiment which includes 4 concentration gradients of trigger RNA added. This time, we utilized two models: hsc_circ_0001982 as trigger /GAPDH as guide (abbreviated as 1982 trigger GAPDH), and 1785 trigger GAPDH. We annealed the synthetic GAPDH primers to form dsDNA firstly, and then added the igRNA expressed by cell-free system and different concentrations of cell extraction liquid. The results are shown below in Fig.21.

Fig.21 Results of igRNAs of 1982 trigger GAPDH, and 1785 trigger GAPDH (trigger RNAs are non-synthetic)

Trigger RNAs from left to right: 1) cell extract 1µl, 2) cell extract 0.5µl, 3) cell extract 0.05µl, 4) cell extract 0.125µl, 5) cell supernatant(MBA-MD-231), 6) cell supernatant(mcf7), 7) positive control, 8) negative control

As we can see in the figure above, hsc_circ_0001982  is more efficient as a trigger RNA than hsc_circ_000 1785 since the fluorescent in the first set of tubes is much stronger than that in the second set of tubes. Trigger hsc_circ_0001982  can be detected by the system even given an extremely low concentration. However, trigger hsc_circ_0001785  can be detected only when at least 0.5 µl of the cell extraction liquid is added.

- Utilizing non-synthetic dsDNA and trigger RNA

In order to prove that our Cas12a system works not only with synthetic dsDNA and trigger RNA, we decided to add cell extracted liquid as trigger RNAs and reverse transcripted and then isothermally amplified cell extract liquid as dsDNA. We added 1982 primers, 1785 primers, and GAPDH primers to the MBA-MD-231 cell extract liquid and did isothermal amplification to make them become dsDNAs we can apply to our system.

We created three models to prove our concept: 1982 trigger 1785, 1785 trigger 1982, and 1982 trigger GAPDH. The results are shown below in Fig. 22, 23, 24.

Fig.22 Results of igRNAs of 1785 as dsDNA and 1982 as trigger RNA

Trigger RNAs from left to right: 1) cell extract 1µl, 2 ) cell extract 0.5µl, 3 ) cell supernatant(mcf7), 4 ) cell supernatant ( MBA-MD -231), 5 ) positive control, 6 ) wastage; dsDNA utilizes isothermally amplified product (with 1785 primer)

Fig.23 Results of igRNAs of 1982 as dsDNA and 1785 as trigger RNA

Trigger RNAs from left to right: 1) cell extract 1µl, 2 ) cell extract 0.5µl, 3 ) cell supernatant(mcf7), 4 ) cell supernatant ( MBA-MD  -231), 5 ) positive control, 6 ) wastage;  dsDNA utilizes isothermally amplified product (with 1982 primer)

Fig.24 Results of igRNAs of GAPDH as dsDNA and 1982 as trigger RNA

Trigger RNAs from left to right: 1) cell extract 1µl, 2 ) cell extract 0.5µl, 3 ) cell supernatant(mcf7), 4 ) cell supernatant ( MBA-MD  -231), 5 ) positive control, 6 ) wastage;  dsDNA utilizes isothermally amplified product (with GAPDH primer)

All of them showed fluorescent signal, including in cell extracts and supernatants of cancer cells MBA-MD-231 and mcf7, which indicated our system was able to be applied to real-life usage. However, through comparison of the intensity of these signals, we found out that 1982 acts as a better trigger than 1785; the supernatant of mcf7 cells was more efficient than the cell supernatant of MBA-MD-231.