Team WorldShaper_HZ aims to produce a kit to
efficiently,
rapidly and easily detect two circRNA biomarkers for the diagnosis and prognosis of breast cancer. The kit
is
developed using a CRISPR-Cas12a system and a cell-free system.
We have achieved the following contributions.
1
Characterization of
part BBa_K2961003
We
incorporated BBa_K2961003 into three guide
RNAs and
tested their sensitivity in binding with Cas12a enzymes in a CRISPR-Cas12a system. The results showed that
BBa_K2961003 worked efficiently as a
Cas12a
handle region in gRNAs for the CRISPR-Cas12a system.
2
Characterization of
part BBa_K3859000
We
incorporated BBa_K3859000 into a guide RNA
(gRNA)
and analyzed its efficiency in guiding the gRNA in a CRISPR-Cas12a system by comparing with another gRNA
using
the same Cas12a handle but a different guide sequence. The results showed
that BBa_K3859000
worked efficiently as a
guide
sequence in gRNA for the CRISPR-Cas12a system.
3 Modification of Part
BBa_K2961003
We has modified the part from
iGEM19_CMUQ team (BBa_K2961003, http://parts.igem.org/Part:BBa_K2961003) to
TAATTTCTACTCTTGTAGAT (BBa_K4409000, http://parts.igem.org/Part:BBa_K4409000).
The old part is TAATTTCTACTAAGTGTAGAT,
it is the sequence on the cas12a handle, used to combine
with guide RNA.
We modified the part by change the sequence AAG from the old part
(BBa_K2961003) to CT, intended to enhance the sensitivity of the Cas12a handle,
and
increase the ability of combining with guide RNA. In this way we
could increase
the signal produced by the system for detection.
In order to modify the part, we used T7
promoter
(AATACGACTCACTATA) and T7
terminator
(CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG),and
used pET-28a (+)
plasmid and TSC-C14 DH5a chemically competent cells
for expression and validation.
We designed igRNAs with BBa_K2961003 or
BBa_K4409000 as a Cas12 handle sequence
and with
different trigger and guide sequences and used these igRNAs in a
CRISPR-Cas12a
system. Fluorescence was analyzed after the reaction to compare the sensitivity of the two
sequences in binding with Cas12a enzyme.
The results showed that
the groups using
BBa_K2961003 as
the Cas12a handle had a stronger signal than the groups using BBa_K4409000. This
demonstrated that changing AAG into
CT cannot be
more efficient in combining with Cas12a enzyme. However, both
parts were workable
in the CRISPR-Cas12a system. Our
results provide reference for future teams when
developing parts for sensitive Cas12
handles.
Figure 1: Signal
intensity of the CRISPR-Cas12a system with AAG
sequence
(BBa_K2961003) and CT sequence (BBa_K4409000)
4
The optimal concentration of each component in
a CRISPR-Cas12a system was determined
1.1 Fluorescence probe concentration
optimized
Firstly, we determined the best concentration of a
PET fluorescence probe within a CRISPR-Cas12a
system to give the strongest
fluorescence signal.
A typical PET fluorescence probe system is constructed
of a
recognition receptor (R) and a fluorophore
(F) linked
by a spacer (S). F is
the
site of light energy absorption and fluorescence
emission. R can bind
the analyte. Before the
binding, photons absorbed by F produce electron transfers from R to F and
result
in no or very weak fluorescence. After the binding, the
photo-induced
electron transfer is inhibited, and
F emits strong
fluorescence.
Figure 2. Schematic PET mechanisms for fluorescent fluoride
probes. HOMO: highest occupied molecular orbital;
LUMO: lowest unoccupied molecular orbital. (Jiao,
2015)
For the system to have the strongest fluorescence signal, it is important to have the
perfect concentration of the probe. After a series of tests, we found that 1.5 µl of fluorescence
probe
plus 5.8 µl of water in a 30 µl CRISPR-Cas12a system
produces the strongest fluorescence signal. This strong
fluorescence signal is very useful in determining if a CRISPR-Cas12a system
is
working properly or not. This protocol can be used as a reference for other research groups developing
CRISPR-Cas12a systems for various purposes.
[H2O=Nuclease-free
water]
For the first three tubes (from left to right:
“3μl”, “0.5μl”, and
“1.5μl”), each contains 0.5
µl of
circ1785 trigger RNA, 0.5 µl of circ1785 igRNA, 1.2 µl of GAPDH dsDNA, 1 µl of buffer,
and 0.5 µl of Cas12a protein. In addition, the
“3μl” tube contains 3 µl of
probe +
3.3 µl of H2O; the
“0.5μl”
tube contains 0.5 µl of probe + 5.8 µl of H2O; the
“1.5μl” tube contains 1.5 µl of probe + 4.8 µl of
H2O; the “H2O” tube
contains 10 µl of H2O.
Figure 3 Comparison of fluorescent signals produced by
PET fluorescent probes with different concentrations in the
30µl CRISPR-Cas12a system
5 Hardware:a
fluorescence detection kit
The fluorescent signals of our CRISPR-Cas12a-based circRNA detection tool require
observation under UV light. Because UV exposure can cause damage to human body, we designed a detection
kit to
shield UV light during observation. The detection kit is cheap to build and can be used conveniently and
safely
for visually checking fluorescence of samples in tubes under UV light.
Our detection kit is an observation box. A UV lamp is placed vertically inside the
box with
its switch outside the box. The switch can be moved manually. A test tube
rack is
made to hold sample Eppendorf tubes in a line, and can slide in and out of the box horizontally in the
right/left direction like a drawer. To check whether fluorescent signals are given by the sample tubes
under UV
light, the tubes are inserted in the rack, the rack is then slid into the box until the box is fully
sealed. The
rack is placed exactly 2-3 cm in front of the UV lamp when it is in the box so that UV light incidents
right on
the bottom of the tubes. A glass window that blocks UV light is installed in the front wall of the box for
the
observer to see if any fluorescence is emitted from the tube bottom. When UV light is on during the
process, UV
radiation is shielded in the box and no damage is done to the observer.
Figure 4
A 3D model
of our device
