Team:OUC-China
This notebook contains the timeline of our iGEM journey. Library： Pool_fwd has T7 promoter sequence: TAATACGACTCACTATAGGG Still use Pool_fwd and Pool_rev primer in reverse transcription
Run 20 circles. Monitor size and quality of the PCR product on a 1.5% agarose gel. Take the optimum number of cycles for 123bp. 1.Aliquot the 30 μL to sterile and RNase-free tubes, then centrifuge to prevent drops from hanging on the wall. Incubate overnight (16h) at 37 °C. 1.Mix 10uL RNA, 10uL 2nM CO and 40uL 5×SELEX buffer, add DEPC to 200uL. Conduct RNA Antisense Purification (RAP) at round 3, 6 and 9. Almost all the steps are same as above except that we should add a step after step 7:
Add 100 μL 1mM sorbitol and 100 μL 1×SELEX buffer to resuspend the pellets, then incubate for 5 min. Remove supernatant.
1.Desperately dissolve RNA9, RNA10-1 dry powder using DEPC water. 1.select 13 concentrations of RNA（0，0.1，0.2，0.3，0.4，0.5，0.75，1，1.5，2.5，5，7.5，10μM） Group 1: GABA (30mM) , transporting RNA (0.6 μM) and exosome (15 μM) were added to the buffer 50mM HEPES (pH 7.0) respectively, which contains 50mM Naci and 7mM CaCl2. The buffer was prepared with DEPC water.
Group 2: GABA (20 mM) , transporting RNA (0.6 μM) and exosome (15 μM) were added to buffer 50 mM HEPES (pH 7.0) respectively, which contains 50 mM NaCI and 7 mM CaCl2. The buffer was prepared with DEPC water. Group 3: GABA (10 mM) , Transporting RNA (0.6 μM) and exosome (15 μM) were added in buffer 50mM HEPES (pH 7.0) respectively, which contains 50mM Naci and 7mM CaCl2. The buffer was prepared with DEPC water. Zero calibration group: Transporting RNA1(1.5 μM) and exosome (15 μM) suspensions were added to buffer 50 mM HEPES (pH 7.0) respectively, which contains 50 mM NACI, 7 mM CaCl2. The buffer was prepared with DEPC water. 1.The system was transferred into 4 ° C incubator. 1. Microscopy: to ensure that the sample is not infected with bacteria. Place sorbitol in a chromatography cabinet; and shovel a certain mass of ice. 50mg 2-IP was dissolved in 50ml of distilled water, and the bacteria were removed by 0.22 μm filter membrane in the clean bench, and stored at 4 ° C. 1.activation of strain: 100μL of preserved glycerol stock Aureobasidium melanogenum P16 strain fluid was cultured at 28°C 175rpm for 24 hours in rocking device. 1.Activation of strain: 100μL of preserved glycerol stock Aureobasidium melanogenum P16 strain fluid was cultured at 28°C,175rpm for 24 hours in rocking device. Seen in Part 1 1.Add IPTG to induce protein expression (2.39mL 210mMIPTG per liter media). 1. Fold the weighing paper along the diagonal, weigh 0.2g agarose, then pour it into the conical flask.
Notebook
Protocol
2.Add 1/10 vol 3M NaAc(pH=6.5).
3.Add 4ul Glycoblue.
4.Add 2.5 vol ethanol pre-cooled at 20 °C, then Incubate the reaction for 1 h.
5.Centrifuge at 4°C for 15min, remove the supernatant, dry for 5 min in the super clean bench, then resuspend by 20ul DEPC.
6.Measure the RNA purity.
2.Heat the solution for 5 min at 65 °C, then put at 21°C for 30min to form RNA-CO complex.
3.Take 20uL pellets and wash the pellets thrice with 200uL B&W buffer (5 mM Tris–HCl, pH 7.5, 1 M NaCl, 0.5 M EDTA), then wash once with 200μL 1×SELEX buffer.
4.Mix the washed pellets and RNA-CO complex and incubate for 1h at 37°C.
5.Remove supernatant (i.e. unbound RNA and CO) after placing the tube on a magnetic rack for 1min.
6.Resuspend by 200uL 1×SELEX buffer, then shake it gently, then incubate for 5 min. Remove the supernatant.
7.Repeat step 6 for 2 times.
8.Resuspend pellets by 100uL 300mM mannitol and 100uL 1×SELEX buffer, then incubate for 1h. Collect the supernatant.
9.Add 20uL 3M pH5.5 NaAc and 2.5 times volume 100% absolute alcohol, then add 4uL ClycoBlue and store at -20°C for 1h.
10.Centrifuge at 4°C for 15 min and remove supernatant. Dry for 5 min and then add 20uL DEPC to dilute.
11.Use reverse transcription kit to conduct RT-PCR.
2. 4 μM RNA9 and 2 μM RNA10 was incubated at room temperature with 50 mM HEPES (pH 7.0) , 50 mM NaCl, 5 mM MGCL2, and 2 mM Cacl2 for 15 min. (the whole volume of this system is about 1 ml). Obtain the corresponding transfer RNA1 and transfer RNA2.
2.Add 100μL 300mMGABA and 10μL 1×SELEX buffer, incubate for 1h under RT.
3. Use microplate reader to measure the fluorescence intensity of cells with excitation wavelength at 485 nm and emission wavelength at 525 nm.
PS: The final concentration is shown in parentheses. The system size of the four groups was the same, and each group had 7 parallel samples for different sampling time.
2.Before sampling, the mixture was slightly oscillated and 5 ml was sampled every 20 min within 120 min.
3.After sampling, the exosomes were removed by centrifugation. (The exosomes have to be completely removed.)
PS: This step can be regarded as a termination step, sample processing can be stopped at this step
4.The concentration of GABA in 1 ml supernatant was detected by BERTHERLOT method.
i.4 ml pH 9.0 borate buffer and 1.4 ml 6% phenol were added respectively into the test tube and mixed.
ii. Put it in a 40℃water bath, add 2.2mL 5% sodium hypochlorite solution by drop, and stay 20mins for coloration at a constant temperature.
iii. Add DEPC water and dilute to 10 ml.
5.The absorbance at 645 nm wavelength was measured in order of GABA concentration from low to high (Use zero calibration Group to calibrate).
PS: the absorbance of Group 1 and Group 2 should be measured after zero calibration of the corresponding Group 3 samples.
2. 40mL solution was taken to a large centrifuge tube and centrifuged at 5000r for 5min at 4℃
3. At room temperature, the supernatant was removed, resuspended with 40mL of pretreatment solution and 400mL DTT for 30min
4. It was centrifuged at 5000r for 5min at 4℃
5. The supernatant was discarded and 10-15mL of sorbitol was added for cleaning. After three replicates, the samples were centrifuged at 5000r for 5min at 4℃
6. According on the bacterial volume, 1 – 2mL of sorbitol was added for resuspension
7. Add the mixture of 200 μL bacterial solution (80 μL) and 30 μL plasmid into an EP tube , then transfer it into an electric cup, stand on ice for 10-15min.
8. A 1mL EP tube, 500 μL YPD and 500 μL sorbitol was taken
9. Electric turn
10. In the clean bench, 1 mL solution of mixing YPD with sorbitol was added and the solution from the transfer cup was transferred to the sterilized empty EP tube
11. Body resuscitation: knockdown for 1.5-2h, extinction resistance for 1h, and expression
12. Carry out plate coating
2.Culture of the strain: The 100μL of Aureobasidium melanogenum P16 strain fluid was inoculated into 8 tubes of 5ml YPD liquid medium and labeled, then cultured in rocking device at 28°C,175rpm for 8h.
3.Measurement: The culture tubes of 0,2,4,6,8,10,12,14 hours were taken out in turn. Next, using microplate reader to measure the concentration of the culture at 600 nm and the fluorescence intensity of the green fluorescent protein at 485 nm and 520 nm , respectively.
4.Draw the curve: The growth curve of Aureobasidium melanogenum P16 can be drawn by plotting a set of OD values and the corresponding incubation time. The background expression intensity of SSRE promoter was plotted as the ratio of the measured fluorescence intensity to the OD value and the corresponding time.
2.Culture of the strain: The 100μL of Aureobasidium melanogenum P16 strain fluid was inoculated into 40 tubes of 5ml YPD liquid medium and labeled, then cultured in rocking device at 28°C,175rpm for 8h(The OD value was 0.4).
3.10 tubes of cultured bacteria solution were taken out and different volumes of 2-IP solution were added to make the final concentration of 2-IP reach 0,0.5, 1,1.5, 2μmol/L.
4.Measurement: Add different concentrations of 2-IP to 200uL of bacteria solution, each concentration was incubated for 0,0.5, 1.25, and 1.5h. Then, measuring the express intensity of the green fluorescent protein at 485 nm and 520 nm , respectively.
2.Add 50μl 0,50,100,150,200,250,300 mM GABA in LB liquid mediums respectively.
3.Cells were grown in shaking LB liquid media overnight at 37℃.
4.The culture was diluted 1/100 fold, cultured for 3 hours at 37℃.
5.The fluorescence intensity of cells was measured by microplate reader with excitation wavelength at 485 nm and emission wavelength at 525 nm.
6. Negative control experiment and blank control experiment were carried out according to the above steps (Negative control: Do not add the IPTG and GABA; Blank control: Add IPTG but do not add GABA).
2. Pour 20mL TAE buffer into the flask and put it in the microwave oven for 3 minutes, until the agarose is completely dissolved.
3. Inject 2μL GelRed into the liquid.
4. Inset the “comb” into the liquid. Let it stand until the gel is solidified.
5. Transfer the gel into the electrophoresis chamber, then pull out the “comb” gently. Pour into enough TAE buffer until the gel is submerged.
6. Carefully use the pipette to transfer a 3μL marker into the first hole, then add 2μL PCR products in the rest holes.
7. Set the voltage to 100V and the current to 100mA, turn on the power and wait for 40 minutes.
8. Take out the gel and place it into the UV transilluminator and turn on the UV light.
9. Compare with the marker, and determine the length of DNA.
10.Recover the gel.