Partnership | Montpellier

Partnership with iGEM IISER Mohali team

We contacted the iGEM IISER Mohali team members after visiting their instagram page. By navigating on their page, we realized that our projects have a common point: detection of bacteria. In fact, they developed a Neural Chip-based Simultaneous Microbial detection using Aptamers for three microorganisms: E.Coli, S.typhimurium and fungus Penicillium. We did several meetings to explain our respective projects in more detail and we agreed on the following partnership: they model an aptamer to detect V.Aestuarianus and we design guide RNA to detect E.Coli by following the same principle of our guide RNA design.

The first dry lab experiment we did for them was to find a relevant gene to target. We chose the 16s rRNA gene because it is well known to be used for bacteria identification and classification, moreover it is highly conserved (1) The next step was to choose three 28 nucleotides sequences to test several synthetic target sequences. The last step was to design the corresponding guide RNA for each target sequence. All the designed sequences are available on table 1.

Name Sequence Comment

P_16s_01_RV GTTAAAACTCAAATGAATTGACGGGGGCgttttagtccccttcgtttttg Reverse primer used to obtain the guide RNA n°01

P_16s_02_RV GGAGCAAACAGGATTAGATACCCTGGTAgttttagtccccttcgtttttg Reverse primer used to obtain the guide RNA n°02

P_16s_03_RV TAAGTCAGATGTGAAATCCCCGGGCTCAgttttagtccccttcgtttttg Reverse primer used to obtain the guide RNA n°03

G_16s_01 gaaattaatacgactcactataggggatttagactaccccaaaaacgaaggggactaaaacGCCCCCGTCAATTCATTTGAGTTTTAAC Full guide RNA 01 sequence - PCR product

G_16s_02 gaaattaatacgactcactataggggatttagactaccccaaaaacgaaggggactaaaacTACCAGGGTATCTAATCCTGTTTGCTCC Full guide RNA 02 sequence - PCR product

G_16s_03 gaaattaatacgactcactataggggatttagactaccccaaaaacgaaggggactaaaacTGAGCCCGGGGATTTCACATCTGACTTA Full guide RNA 03 sequence - PCR product

T_16s_01 ctcggatacccttactctgttgaaaacgaatagataggttgaaatTAATACGACTCACTATAGTAACGCGTTAAGTCGACCGCCTGGGGA
GTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACccaggcatc
ataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcac
cttcgggtgggcctttctgcgtttataattattgaccacttccgagtagaatcgtgcttcagtaaga Full synthetic target sequence 01

T_16s_02 ctcggatacccttactctgttgaaaacgaatagataggttgaaatTAATACGACTCACTATAGccccctggacgaagactgacgctcaggtgc
gaaagcgtggggagcaaacaggattagataccctggtagtccacgccgtaaacgatgtcgacttggaggttgtgccctccaggcatcaaataa
aacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgg
gtgggcctttctgcgtttataattattgaccacttccgagtagaatcgtgcttcagtaaga Full synthetic target sequence 02

T_16s_03 ctcggatacccttactctgttgaaaacgaatagataggttgaaatTAATACGACTCACTATAGATCGGAATTACTGGGCGTAAAGCGCACGCAG
GCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGccaggcatcaaataaaacgaa
aggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttc
tgcgtttataattattgaccacttccgagtagaatcgtgcttcagtaaga Full synthetic target sequence 03

Table 1: designed sequences to detect E.Coli strain DH5a

The second experiment was to do the fluorescence assay to test the target sequences. We obtained positive results only for one sequence: the sequence number 1. These first results encourage us, in the future, to adapt the lateral flow assay to other pathogens than V.aestuarianus.

Figure 1: Shell’lock detection of E.coli 16sRNA. The lines represent the evolution of the fluorescence measured from the shell’lock experiment over time. The color represent the different target RNA tested.

On their hand, they managed to develop an aptamer for us but because of the long time it takes we decided all together that they will not realize the wetlab experiments to detect vibrio aestuarianus. Results of their work can be found in their wiki .

Throughout this collaboration we showed that it is possible to detect bacteria using two different techniques. The two can be used in parallel as complementary techniques.

Table 1: designed sequences to detect *E.Coli strain DH5a*
Name	Sequence	Comment
P_16s_01_RV	GTTAAAACTCAAATGAATTGACGGGGGCgttttagtccccttcgtttttg	Reverse primer used to obtain the guide RNA n°01
P_16s_02_RV	GGAGCAAACAGGATTAGATACCCTGGTAgttttagtccccttcgtttttg	Reverse primer used to obtain the guide RNA n°02
P_16s_03_RV	TAAGTCAGATGTGAAATCCCCGGGCTCAgttttagtccccttcgtttttg	Reverse primer used to obtain the guide RNA n°03
G_16s_01	gaaattaatacgactcactataggggatttagactaccccaaaaacgaaggggactaaaacGCCCCCGTCAATTCATTTGAGTTTTAAC	Full guide RNA 01 sequence - PCR product
G_16s_02	gaaattaatacgactcactataggggatttagactaccccaaaaacgaaggggactaaaacTACCAGGGTATCTAATCCTGTTTGCTCC	Full guide RNA 02 sequence - PCR product
G_16s_03	gaaattaatacgactcactataggggatttagactaccccaaaaacgaaggggactaaaacTGAGCCCGGGGATTTCACATCTGACTTA	Full guide RNA 03 sequence - PCR product
T_16s_01	ctcggatacccttactctgttgaaaacgaatagataggttgaaatTAATACGACTCACTATAGTAACGCGTTAAGTCGACCGCCTGGGGA GTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACccaggcatc ataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcac cttcgggtgggcctttctgcgtttataattattgaccacttccgagtagaatcgtgcttcagtaaga	Full synthetic target sequence 01
T_16s_02	ctcggatacccttactctgttgaaaacgaatagataggttgaaatTAATACGACTCACTATAGccccctggacgaagactgacgctcaggtgc gaaagcgtggggagcaaacaggattagataccctggtagtccacgccgtaaacgatgtcgacttggaggttgtgccctccaggcatcaaataa aacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgg gtgggcctttctgcgtttataattattgaccacttccgagtagaatcgtgcttcagtaaga	Full synthetic target sequence 02
T_16s_03	ctcggatacccttactctgttgaaaacgaatagataggttgaaatTAATACGACTCACTATAGATCGGAATTACTGGGCGTAAAGCGCACGCAG GCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGccaggcatcaaataaaacgaa aggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttc tgcgtttataattattgaccacttccgagtagaatcgtgcttcagtaaga	Full synthetic target sequence 03

References

1. Rosselli R, Ramoli O, Vitulo N, Vezzi A. Direct 16S rRNA-seq from bacterial communities: a PCR-independent approach to simultaneously assess microbial diversity and functional activity potential of each taxon. 2016 Aug; Available from: https://doi.org/10.1038/srep32165