We discovered our projects on Instagram in July. We were requested to set up a meeting to discuss how our teams could collaborate by Team-Montpellier. We exchanged information about our project and realized that they worked to detect Vibrio aestuarianus, a bacteria in oysters. They wanted to use the SHERLOCK technique based on CRISPR Cas13 collateral activity to detect the pathogen in water samples, and we were working on bacterial detection via aptamers.

After our first conversation in July, we decided to focus our collaboration on the dry lab. They proposed to design the detection system of our bacteria through SHERLOCK, and we can help them to detect vibrio through aptamers.

In our partnership with Team Montpellier, we developed an Aptamer to detect Vibrio sp. We used in-silico Aptamer generation methods. We received a protein of interest, ToxR. This protein was chosen as a bio-marker for Vibrio as it is a virulence regulator in Vibrio species. The protein regulates gene loci T3SS1 and Vp-PAI. The protein is involved in Quorum sensing. ToxR is a positive regulator of Thermostable direct haemolysin (TDH). TDH causes erythrocytic rupture by interfering with the cell membrane integrity. It is a pore-forming toxin (PFT). Post-oligomerization forms heptameric complexes that increase the water entry into the cells. It is indicative of Horizontal gene transfer and hence forms a suitable target for our Aptamer. Genes in the loci are TCP (toxin-correlated pillus) and ct (cholera toxin). The positive result from our Aptamer would hence indicate only the presence of pathogenic vibrio and reduce false positives due to background interference from similar proteins expressed in non-virulent strains.

We first conducted a homology search of the target protein to help identify regions that could be targeted to ensure the specificity and selectivity of the Aptamer. This was done using NCBI BLAST search followed by a Clustal W analysis of the proteins. We noted that the protein was common in Vibrio Species, but the DNA binding regions showed several differences making it the perfect target. Most of the differences were noted in the amino acid sequences in the w-THT region, suggesting a narrower search space for our Aptamer.

We also noted that the protein of interest was an internal membrane protein. The initial Aptamer generated was larger than what could be transported into the inner membrane. Hence we planned on adding an initial lysis step to be able to target the region of interest in the protein. A stability analysis was performed to note if the protein would survive the lysis step.

In the stability analysis, we docked the individual chains of the protein and noted the binding energy. The protein-protein docking was conducted for all five conformations of 7NMB and seven conformations of 7NN6. This set of 35 dockings gave us the average binding energy for the complex. We also reperformed the docking changing the receptor and ligand to verify that the change in the energy was minimal. The final docked binding energy was found to be -640.34kJ/mol, which is lower than the energy released on membrane dissociation, and hence confirmed that the protein would not dissociate due to the lysis step.

We then modelled the structure of the 7NMB again using a homology modeller, Jpred4, to obtain the following. This was followed by a homological alignment of all the conformers of 7NMB obtained from crystallographic data. This was done to ensure that the protein of interest accurately matched the average of the docked conformers.

We selected the region of interest as a protein 7NMB. The target showed a high affinity for AT-rich sequences when docked against a random list of nucleotide triplets.

Using the DPP-PseAAC server, we identified the DNA binding propensity of 7NMB. This online server works motif analysis based on the polypeptide content of different DNA-binding proteins. The polypeptides are first vectorized using the PseAAC (pseudo amino acid composition) algorithm to generate a vector out of the polypeptide chain.

To learn more visit our Modelling page

The lambda value used is 5-10 for the web server. The sequence was hence verified to have DNA binding propensity. A further inspection revealed that the 7NMB dimer forms a Wing Helix-Turn-Helix (w-HTH) domain that binds to the required aptamer. The Turn domains form the internal linkage, while the helix domain is the targeted sequence for our Aptamer generation.

A literature review and docking tests confirmed that the protein could bind to the following sequence motif.
5’ATCTTATCTCAAAAAACATAAAATAACATGAGTTACGTAACTCAT
GTTATTTTATGTTTTTTGAGAAGAT3’

Random mutations were made in the sequence, and the best aptamer was selected based on its docking capabilities. The selection based on random mutation was made evolutionarily. An initial set of mutations were made (a set of 10 mutations per strain). This was then sequentially docked with the required protein of interest. The sequence with the best mutation was then further mutated, and this process was repeated for a total of 5 steps. This can be considered an evolutionary process with a single winner, conducted for five generations. This resulted in an aptamer firmly bound to 7NMB, with a binding energy of -573kJ/mol.

While we generated an aptamer for Team- Montpellier, they designed guide RNA to detect E.Coli by following the same principle they followed for their guide RNA design.

Please visit their Partnership page to see the results of their work.

This partnership demonstrated that aptamers and SHERLOCK are two robust bacteria detection methods. Team Montpellier successfully developed SHERLOCK to detect Vibrio aesturianis. Team IISER_Mohali has designed the aptamer and demonstrated it shows strong binding to ToxR (by molecular docking), found in many Vibrio sp., including Vibrio aesturianis. The two techniques can be used to verify the detection accuracy of each other.

Future Plans

1. ToxR gene has been cloned into a plasmid and ordered. The protein will be expressed in E. coli and purified to use for testing aptamers.
2. The aptamers have been ordered and we plan to perform molecular biology characterization:
1. Cloning into plasmid pUC19 and transformation into E. coli DH5α
2. Gradient asymmetric PCR
3. Gel electrophoresis of aptamer electrophoresis to confirm size of aptamer
3. Then we need to confirm the sensitivity of the aptamers towards ToxR using electrochemical analysis - EIS and cyclic voltammetry.