In our project, we established a major depression disorder (MDD) diagnosis platform to detect microRNAs (miRNAs). We developed a paper strip sensor to detect miRNA based on toehold switch and cell free expression system, which facilitate the intuitive detection for MDD at remote areas or resource limited environments or even at home. The experimental protocals are shown as follows.
1. Streak the E. coli stock on a LB-agar plate. Incubate the plate at 37°C overnight.
2. Pick a single well-isolated colony and inoculate it into 3mL of LB broth solution. Incubate it at 37°C overnight (more than 16 h) with shaking at 220 rpm.
3. Transfer 250uL of the saturated overnight solution to a sterile 50mL polypropylene tube containing 25mL of LB medium. Incubate the E. coli at 37°C with shaking at 220 rpm until OD600 reaching 0.6. This usually takes 2.5 h. Check the OD every 30 min after 1 h to avoid overgrowth.
4. When the medium reaches an OD600 of 0.6, chill the tube on the ice for 30 min and then centrifuge at 8000rpm for 1min at 4°C, discard the supernatant.
5. Re-suspend the E. coli in 2.5mL of ice-cold TSS solution with gentle swirling. Incubate on ice for 10 min. Aliquot in 50uL per tube. Now the competent cells are ready to be transformed.
Note: Transformation and Storage Solution (TSS) contains LB medium 85% 8.5mL, PEG (wt/vol, Mw 8000) 10% 1.0g, DMSO (vol/vol) 5% 500μL, and MgCl2 (pH 6.5) 50mM 500μL.
1. Thaw TSS cells on ice.
2. Add 5uL Synthetic plasmid DNA in TSS cells, pipette gently to mix.
3. Incubate it on ice for 30 min with occasional mixing.
4. Heat shock at 42°C for 90 sec.
5. After heat shock, put it on ice for 2 min, add 0.8mL LB medium into the cells.
6. Shake and incubate at 37°C for 60 min at 120 rpm.
7. Take out 100uL medium and spread them on the appropriate agar plates with certain antibiotic.
8. Incubate the plates at 37°C overnight.
9. Pick monoclonal into certain antibiotic LB medium, and incubate the medium at 37°C overnight.
1. The bacteria that contained target plasmid were cultivated at 37°C overnight.
2. Take out 1,500uL solution of cultivated bacteria to a 2mL micro-centrifuge tube. The tube was centrifuged at 12,000rpm for 1 min at room temperature, and then the supernatant was discarded. In this tube, repeating these steps three times to increase the concentration of the bacteria.
3. Add 250uL Solution I buffer to suspend the precipitation. Complete suspension is vital for obtaining good plasmid yield by vortexing or pipetting up and down.
4. Add 250uL Solution II buffer, mix gently upside down 4-6 times to make a cleared lysate. A 2-3 min incubation at room temperature may be necessary. However, this step should not be more than 5 min, and avoid vigorous mixing as doing so will shear chromosomal DNA and lower plasmid purity.
5. Add 350uL Solution III buffer, mix gently and fully upside down 6-8 times, centrifuge the tubes at 12,000rpm for 10 min at room temperature.
6. Put a HiBind DNA Mini Column into a 2mL Collection Tube.
7. The supernatant in step 4 is transferred to the Mini Column, and centrifuged at 12,000rpm for 1 min, the filtrate is discarded.
8. Put the Column back into the Collection Tube, add 500uL HBC Buffer, centrifuge at 12,000rpm for 1 min, the filtrate is discarded.
9. Put the Column back into the Collection Tube, add 700uL Washing buffer, centrifuge at 12,000rpm for 1 min, the filtrate is discarded. Repeat the washing step once.
10. Put the Column back into the Collection Tube and centrifuge at 12,000 rpm for 2 min.
11. Put the Column into a new 1.5mL micro-centrifuge tube and leave it for 2 min at room temperature. Then add 50uL ddH2O to the center of the Column matrix, and leave it at room temperature for 1 min. Centrifuge at12,000 rpm for 1 min. Discard the HiBind DNA Mini Column.
12. Measure concentration of extracted plasmid DNA by nanodrop 1000, and store plasmid DNA at -20°C.
DNA for downstream applications is usually digested with restriction endonucleases. Type II restriction enzymes are the most widely used in molecular biology application.
The reaction volume are carried out in 20µL.
1. Add components to a clean tube in the order as follow:
1 µL DNA (1 µg/µL)
2 µL 10x buffer
1 µL each restriction enzyme (EcoR1 and HindⅢ)
15 µL ddH2O
2. Mix gently and fully, and incubate the tube at certain temperature (37°C) for 1 h.
3. Stop the reaction by heat inactivation (65°C for 15 min).
4. The digested DNA is ready for use in research applications.
In the PCR protocol, reaction components are assembled as described below. The final volume should be 20 µL.
1. Thaw all reagents on ice.
2. Assemble reaction mix into 20 µL volume in a thin walled 0.2 mL PCR tubes as follow:
8uL ddH2O
1µL DNA Template
0.5uL Primer F
0.5uL Primer R
10uL 2x Taq mixture
3. Prepare negative control reaction without template DNA. Prepare positive control reaction with template of known size and appropriate primers.
4. Gently mix by tapping tube. Briefly centrifuge to settle tube contents.
5. Put the tube into a PCR instrument.
6. Set up the following PCR program: initial denaturing at 94°C for 4 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min, plus a final extension at 72°C for 10 min.
7. Check the PCR product by agarose gel electrophoresis.
1. Prepare 100mL 1xTAE buffer with 1g agarose, and boil it three times, shake completely, and waiting for cool.
2. Pour the agarose gel into gel tray, assemble gel pouring apparatus by inserting gate into slots.
3. Allow agarose to cool, place the gel in the apparatus rig with the wells facing the negative end (black-colored).
4. Fill the rig with 1x TAE buffer.
5. Load 8μL of DNA maker into lane.
6. Mix 1μL of 10x loading buffer with 5μL DNA sample, load them into lane.
7. Run at 100V for 30 min.
8. Use the Gel imaging system to check the gel and take a picture.
9. Deal with the gel carefully as medical waste.
1. Design knock-out primers according to the sequence of knock-out target gene, lacZ, and replace kanamycin gene for screening. The primers were designed as follows.
Forward primer: 5’ATGACCATGATTACGGATTCACTGGCCGTCGTG TAGGCTGGAGCTGCTTC3’
Reverse primer: 5’TTATTTTTGACACCAGACCAACTGGTAATGATGG GAATTAGCCATGGTCC3’
2. The PCR system was prepared, and the pET-28a plasmid was used as the template to amplify kanamycin gene with the homologous arm primers.
3. After the PCR reaction, the gene fragment with a size of about 1.6 Kb was identified by electrophoresis.
4. The PCR product was purified and obtained the homologous arm fragment containing kanamycin gene.
5. The homologous arm linear fragment obtained above was mixed with competent cells of E. coli BL21 (DE3), transfected by heat shock method at 42°C, and then the bacterial solution was coated on LB plates containing kanamycin resistance to obtain BL21 ∆ lacZ mutant engineering strain.
6. To further verify the kanamycin resistant BL21 mutant strain with lacZ gene deletion, colony PCR method was used to confirm it. The lacZ primers are as follows: lacZ-F: 5’ ATGACCATGATTACGGATTCACTGG3’ and lacZ-R: 5’ TTATTTTTGACACCAGACCAACTGG3’. The PCR protocol refers to the above.
1. Choose the single colonies of the engineered bacteria constructed above and inoculate them in 5 ml LB medium, and culture them overnight at 37°C at 220 rpm in a shaker.
2. The next day, the medium above was transferred to 300 mL of 2 × YTPG medium, and cultured at 37°C on a shaker at 220 rpm.
3. When the OD600 value of the bacterial concentration grows at the later logarithmic period, the bacteria are collected. Centrifuge 10000g for 1 min and remove the supernatant.
4. Suspend the bacteria with the precooled S30 buffer, mix well with a shaker, and mix at 4°C and 8000g for 7 min and remove the supernatant. This step is repeated 3 times, and all traces of the supernatant is finally discarded.
5. Add 1 mL precooled S30 buffer to every 1g of bacteria and mix well.
6. Cells were crushed with a ultrasonic cell breaker, turn on for 2S, turn off for 2S, the total time is 15m, and the temperature alarm is set at 40°C.
7. Centrifuge the tube at 4°C, 12000g for 20 min and take the supernatant into a new tube, freeze it in liquid nitrogen, and store it in the refrigerator at -80°C. Ready for use as the lysate extract.
Note: 2 × YTPG medium:22 mM potassium dihydrogen phosphate, 40 Mm dipotassium hydrogen phosphate, 100 mM glucose, 16 g/L tryptone, 10 g/L yeast extract, 5 g/L sodium chloride. S30 Buffer: 10 mM Tris-acetate (pH8.2), 14 mM magnesium acetate, 60 mM potassium glutamate, 2 mM DTT.
1. Prepare 11 mixtures in advance: 9 mM magnesium acetate, 90 mM potassium glutamate, 80 mM ammonium acetate, 57 mM HEPES-KOH, 0.171 mg/mL tRNA, 0.034 mg/mL folic acid, 2 mM dithiothreitol, 1 mM putrescine, 1.5 mM spermidine, 4 mM oxalic acid, 33 mM sodium pyruvate.
2. Prepare cell-free reaction system (15 µL): 6 µL 11 mixtures, 1.2 mM ATP, 0.86 mM GTP, CTP and UTP, 5% (V/V) PEG-8000, 0.1 mM phosphoenolpyruvate （PEP）, 0.27 U/µL RNase inhibitor, 2 mM 20 kinds of amino acids, 25% (V/V) E. coli BL21 Δ Lac Z cell lysate extract, 5% (V/V) 20 mg/mL X-gal chromogenic substrate.
3. Add 5 nM pET-28a-miR-34a-5p-lacZ toehold switch plasmid.
4. Incubate at 37°C for 1 h, and record the color change of the solution.
Note: use colored protein as indicator, add corresponding toehold switch plasmid, and do not add X-gal substrate.
1. Put the Whatmann filter paper strips (0.6 × 4 cm) into the culture dish, add 5% bovine serum protein solution to completely cover the paper, and block it overnight at 4°C.
2. The next day, discard the 5% bovine serum protein solution in the culture dish, add ddH2O to moisten the filter paper, place the culture dish in decoloration shaker, incubate for 5 min, and discard ddH2O.
3. Repeat step 2 and wash the filter paper 5 times.
4. Open the lid of the culture dish and place it in the electric constant temperature drying oven. Dry the filter paper for use.
5. Spot a volume of 7 μL of E. coli BL21 Δ LacZ cell lysate extract on Whatmann filter paper strips at spots pre-marked with a pencil.
6. Put it in an ultra-low temperature refrigerator at - 80°C for 6 h.
7. After precooling in the freeze dryer, the paper pieces are sealed with cling film, and the cling film is perforated for ventilation to freeze dry overnight.
8. Stored the filter paper sensing strips at 4°C until used.