RESULT

Identification of Artificial SPIKE-Interacted Small Peptides

1. Construction of random library

The random fragment (iGEM_Fragment-1) was synthesized, and the double-strand sequence were obtained by PCR amplification with fragment amplifying primers (Random_Primer1, Random_Primer2). The obtained PCR products were constructed into entry vector pDONR207 by Gateway BP reaction, resulting in the primary library pONR207-random peptide (Figure 1). The pDONR207-random peptide plasmid library was subsequently constructed into the destination vector pGADT7-GW through Gateway LR reaction (Figure 2), resulting in a yeast two-hybrid AD plasmid library. The secondary plasmid library (pGADT7 GW-random peptide) was then transferred into the yeast Y187 strain, resulting in a Y187 AD-tagged random-peptide library (Figure 3).

1. Adaptor information for the Gateway system

Figure 1. The pDONR207 was used for the construction of the Entry library. The cyan bar shows the DNA sequences coding the random peptide library.

Figure 2. The pGADT7 GW was used for the construction of the secondary library. The gray bar shows the DNA sequences coding the random peptide library.

Figure 3. The colonies of AD-random Libray in AH109 strain.

2. The characteraztion of the Yeast two hybrid Library

The 150-bp insert fragments were amplified using primers CCAGATTACGCTCATATGACAAGTTTGTAC and TCATCTGCAGCTCGAGACCACTTTGTACAA. The constructed libraries were sequenced using the Illumina Novaseq 6000 platform to generate raw data, following the manufacturer’s instructions by the company of ANNOROAD Biotech. Co., Ltd. (China). After quality control, about 34.5 GB of clean data were generated. According to the design principles (TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACC-(NNK)20-TAAGACCCAACTTTCTTGTACAAAGTTGTGCGGCCGCC), 60bp random sequences were extracted from the clean data and translated into amino acid sequences using standard genetic codons. The translation was stopped from the first stop codon, and peptides less than five aa in length after translation were removed. Finally, we obtained 68,190,232 peptides in total and 3,359,176 peptides after removing redundancy. (table1)

Table 1: Statistics of sequencing results

We carried out saturation analyses and found that about 35Gb data was far from covering all the kinds of peptides in our random peptide library (Figure 4A), indicating that our random peptide library has a high diversity and a broad potential for protein interaction investigations and applications.

Figure 4. statistics of the sequencing data about our random peptide library. (A) Statistics of the peptide number of different lengths; (B) Saturation analyses according to randomly sampling from the sequencing data. The abscissa represents the proportion of random sampling including 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% and 90%, and the ordinate represents the number of peptides detected corresponding to the percentage of sampled sequencing data.

3. The screening of SPIKE-RBD binding peptides

AH109 strain was transformed with pGWBD_Spkie-RBD plasmid to obtain the bait construction of yeast two-hybrid. Through the yeast two-hybrid mating system (Figure 5A), 36 positive colonies were finally obtained (Figure 5B). After amplification with AD-REV and AD-FWD primers, 35 PCR fragments were obtained, and then 34 random peptide library sequences were obtained by sanger sequencing (Table 1).

Figure 5. The screening of SPIKE-RBD binding peptides through Y2h. (A) The microscopy of the mating process of AH109 and Y187. (B) The positive clonies of mating yeast gown on the –Trp/-Leu/-His/-Ade SD medium.

Table 1.The aa sequences of 34 SPIKE-RBD binding peptides

Figure 6. Multiple sequence alignment of the 34 peptides interacted with Spike, the quality score is calculated for each site in the alignment by summing, and a consensus sequence was generated according to the alignment analysis.