DESIGN
Summary
In this project, we aimed to design a device to detect the presence and concentration of a given pathogeny. Firstly, we need to establish a relationship between the virus concentration in the wastewater and the intensity of the fluorescence signal in a designed bacteria. Secondly, we have to build unique "hands" that hold pathogenic microbes.
The generation of random 20 amino acids peptides Library for the Y2H system
Concept: The yeast two-hybrid (Y2H) system is a screening system for identifying the interacted protein/peptide of a given protein. The Y2H analysis system is based on the principle that many eukaryotic transcriptional activators consist of two physically separate and functionally independent domains, namely the DNA-binding domain (DNA-BD) and transcriptional activation (AD). The former can recognize and bind to specific nucleotide sequences (UAS) in the promoter of the target gene, while the latter activates the transcription of downstream target genes. If the two domains are separated by molecular biological techniques and expressed in the same host cell, the transcription of the response gene can not be activated.
Figure1. Yeast Two-Hybrid Systems
Experiment Procedures:
1. Adaptor information for the Gateway system
3. Sequences synthesis
iGEM_Fragment-1
TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNN
KNNKNNKNNKNNKNNKNNKNNKNNKTAAGACCCAACTTTCTTGTACAAAGTTGTGCGGCCGCC
Random_Primer1
TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACC
Random_Primer2
GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTCTTA
4. Generation of Primary plasmid library
The fragment was constructed into entry vector pDONR207 by Gateway BP reaction, resulting in the primary library pONR207-random peptide.
5. Generation of secondary plasmid library
The pDONR207-random peptide plasmid library was subsequently constructed into the destination vector pGADT7-GW through Gateway LR reaction, resulting in a yeast two-hybrid AD plasmid library.
6. Generation of Y187 AD library
The secondary plasmid library (pGADT7 GW-random peptide) was then transferred into the yeast Y187 strain, resulting in a Y187 AD-tagged random-peptide library.
The design of hACE2 SOE PCR
Concept:
Gene splicing by overlapping extension PCR (SOE PCR) technology was widely used for inducing point mutations with gene sequences in vitro. A pair of complementary primers with point mutations were used for amplifying two fragments of the designated genes along with upstream and downstream primers, respectively. The resulting two PCR products with >20bp overlapping were then recovered and used as templates for amplifying the full length of the gene. Subsequently, the two fragments were spliced by overlapping extension through several rounds of PCR amplification. This technology does not need digestion and ligation procedures, so the location and type of mutations are not restricted, and the mutations could be induced at any point in the DNA sequences.
Experiment Procedures:
Computational biology technologies were used for the molecular evolution of ACE2 evolution to predict the mutations with stronger binding strength to the spike protein. The UCSF CHIMERA was used to simulate the structure of hACE2 based on the RBD with SARS-CoV-2. According to the existing literature, the amino acids in human ACE2 interacting with SARS-COV-2 are L455, F486, Q493, S494, N501, and Y505. By mutating the amino acids at the key sites, we can determine whether the space between the key atoms is smaller (smaller means they are more strongly bound), and we can further verify this inference by calculating the binding energy between the two atoms.
Table 1.ACE2 point mutation predicted enhancement sites
| Number | Spike binding sites | ACE2 | Distance change before and after mutation | Binding energy | Predictions |
| 1 | SARS-CoV-2 | hACE2 | Original sequence | -14.38 | / |
| 2 | Q493 | l_21_V | 6.541->6.506 | -14.15 | Stronger |
| 3 | F486 | K_26_R | 5.132->3.8007 | -14.38 | Stronger |
| 4 | F486 | T_27_A | 9.886->9.387 | -14.39 | Stronger |
| 5 | L455 | K_31_R | 13.985->11.889 | -14.37 |
stronger |
| 6 | F486 | N_33_I | 8.529->8.309 | -14.37 | Stronger |
| 7 | F486 | H_34_R | 15.184->12.349 | -14.36 | Stronger |
| 8 | F486 | E_37_K | 15.175->10.415 | -14.35 | Stronger |
| 9 | F486 | T_92_I | 7.047->7.0247 | -14.38 | Stronger |
Escape model
CheZ
CheZ is a protein derived from Enterobacterium that can influence the behavior of E. coli by phosphorylating CheY. CheY is a key regulator of flagellar motility response, and when it is phosphorylated, it causes the flagella to spin clockwise, and the phosphate protein phosphatase CheZ dephosphorylates CheY, causing the flagella to spin counterclockwise [4]. Studies have shown that when CheZ is knocked out of the chemotaxis pathway, the tumbling of E. coli cells predominates, while the overexpression of CheZ inhibits the tumbling of [5] and causes the high-speed linear movement of E. coli.
Figure2. The E. coli chemotaxis system and its control of motility
EL222
At the same time, with the help of Jilin University, we decided to use EL222, a light control element, which is a bacterium from the bacterium Li-Ray Erythrobacteriace HTCC2594's blue light sensory protein. It consists of a light-oxygen-voltage (LOV) domain that acts as half of the light-sensing domain at the N-terminus, and a LuxR-type spiral-turn-helix (HTH) DNA-binding domain, which acts as an effector domain in the C-terminal half. In the dark, EL222's interaction with DNA is negligible, and when light is activated, DNA binding is significantly enhanced. The DNA sequence of EL222-binding motifs is shown as 5'-RGNYWWRGNCY-3′ (Y = C or T, W = A or T, R = A or G, N = any nucleotide). When the domain is in the dark, the LOV domain non-covalently binds flavin single nucleotides (FMN) to chromophores. Under light, it forms a covalent adduct with nearby cysteine residues, which trigger conformational changes in proteins and transmit light signals. EL222 exists in the dark as a monomer. When blue light is irradiated, EL222 binds to each other to form a dimer that interacts with DNA and stimulates the expression of downstream genes. [6]
Figure3:Blue light induction mechanism of EL222
We couple this light-control gene with CheZ and a toxic protein so that under the exposure of blue light, E. coli will accelerate its movement due to overexpression of CheZ here. At the same time, the suicide gene that promotes autolysis of the bacteria will also begin to be expressed, but its toxicity is not enough to make the bacteria lyse immediately, and our "courier" will look for the area without blue light at high speed during the "countdown to death", once it enters the area without blue light. The bacteria will immediately "brake" and the suicide gene will stop expression. Our "courier" can successfully reach the area without blue light with its "cargo". The result is an increase in the concentration of virus in the blue-free region and almost virus-free in the blue-light area
Figure4:The mechanism by which E. coli "transport" viruses
Detection System
PmrA/PmrB is a two-component regulatory system for salmonella, which is originally sensitive to Fe (III)[7] . The transmembrane sensor protein PmrB contains a histidine kinase (HK-RRB- domain in the intracellular segment, which is self-phosphorylated upon sensing an extracellular marker, the phosphate group is then transferred to the conserved L-Aspartic Acid residues of the intracellular response regulator PmrA. Phosphorylated PmrA becomes an activator of the PmrC promoter to activate downstream genes. The original Fe (III)-sensitive domain of the PmrB was replaced by the core-binding domain of different viral receptors, allowing this two-component system to be sensitive to the spike proteins of different viruses We modified the engineered bacteria provided by Tsinghua, which had been transferred to a two-component system, to sense the external material in the region of the“Tentacle” sequence that we had previously made using a random peptide library. In the presence of external markers, the two-component system will stimulate a series of reactions resulting in a certain fluorescence signal.
Figure5. Design and construction of a lanthanide-responsive system based on the PmrA/PmrB two-component system
Reference
[1] Yang E,Zha J, Jochel J,etal- Bad, a heterodimeric partner for Bcl-xL and Bcl-2,displaces bax and promotes cell death [J]· Cell, 1995,80( 27) :285- 291.
[2] Yang M ,Wu Z, Fields S· Protein- peptide interact ions analyzed with the yeast two-hybrid system [J]· Nucleic Acids Research, 1995,23( 7) :1152- 1156.
[3]Clontech In· Matchmaker gal4 two hybrid sysytem3, 1999:PT3247-1. http://www·clontech·com/tech info/ manuals/PDF/ PT 3247-1. pdf
[4]M.D. Baker, P.M. Wolanin, J.B. Stock, Signal transduction in bacterial chemotaxis (in English), Bioessays 28 (1) (Jan2006) 9–22.
[5]S.C. Kuo, D.E. Koshland Jr., Roles of cheY and cheZ gene products in controlling flagellar rotation in bacterial 3147Blue Light-Directed Cell Migration chemotaxis of Escherichia coli (in English), J. Bacteriol. 169(3) (Mar 1987) 1307–1314.
[6]Takakado A, Nakasone Y, Terazima M. Sequential DNA Binding and Dimerization Processes of the Photosensory Protein EL222. Biochemistry. 2018 Mar 13;57(10):1603-1610. doi: 10.1021/acs.biochem.7b01206. Epub 2018 Feb 20. PMID: 29432690.
[7]Zhang, S. , Han, D. , Ding, Z. , Wang, X. , Zhao, D. , & Hu, Y. , et al. (2019). Fabrication and characterization of one interpenetrating network hydrogel based on sodium alginate and polyvinyl alcohol. Journal of Wuhan University of Technology--Materials Science Edition.
[8]Horton RM, Cai ZL, Ho SN, Pease LR. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques. 1990 May;8(5):528-35. PMID: 2357375.
[9]Luan J, Lu Y, Jin X, Zhang L. Spike protein recognition of mammalian ACE2 predicts the host range and an optimized ACE2 for SARS-CoV-2 infection. Biochem Biophys Res Commun. 2020 May 21;526(1):165-169. doi: 10.1016/j.bbrc.2020.03.047. Epub 2020 Mar 19. PMID: 32201080; PMCID: PMC7102515
