Results

The results of our construct designs and corresponding ligations, transformations, and expression tests are highlighted on this page. Our overall goal to was to introduce foreign protein S gene into the plasmids pFastBac-YMBac-II and pET His6 (2Bc-t) and transform into E. coli DH10Bac cells containing the Bacmid for generating recombinant viral particles in order to achieve expression in SF9 cells using the Bac to Bac baculovirus expression system, and transforming into E. coli cell strains: E. coli Bl21, Origami B (DE3), Origami 2 (DE3) and Origami 2 (DE3) pLysS. Conducting parallel experiments with eukaryotic and prokaryotic expression systems enabled us to understand the feasibility and ability of these expression systems to produce recombinant human protein S. We were also able to generate data that helped us develop an implementation plan to scale up protein S production. In the future, this will help our project on an industrial level, as we aim to create an injectable therapeutic, PROS, for people with protein S deficiency. We were not able to achieve expression from the baculovirus expression system because of time constraints, but we were successful in expressing protein S in Origami B (DE3) cells.

---

Prokaryotic Expression (E. coli)

Verification of Synthesized Insert and Linearized Vector

We obtained our gene of insert through synthesis from IDT. We amplified the insert, which was to be cloned into our vector, using primers designed for the Ligation Independent Cloning reaction. The figure below shows successful amplification of the synthesized gene, containing the overhangs designed for LIC.

We received our expression vector as a generous donation from the Glynn lab at Stony Brook University. We grew overnight cultures of E. coli DH5-alpha cells containing our vector. In total we inoculated 5 different 5 mL bacterial cultures labeled Samples J, K, L, M and N and cultured them overnight at 37°C and 220 rpm. The figure below shows the gel electrophoresis result of PCR amplification of the mini prepped vector using LIC primers.

Construction of the Recombinant Vector

The insert was optimized for the annealing reaction by generating specific overhangs for the LIC reaction by PCR amplification. The vector has a LIC site which is acted upon by the restriction enzyme Hpal, to linearize the vector prior to the LIC reaction. Following are the primer sequences used to generate the complementary overhangs for the annealing reaction;

Forward primer: TTTAAGAAGGAGATATAGTTCATGCGCGTACTTGGCGGACGC

Reverse primer: GGATTGGAAGTAGAGGTTCTCAGAGTTCTTAGTTTTTTTCCAAACTG

After a lot of troubleshooting, we determined the optimal insert and vector concentration ratios for the ligation independent cloning (LIC) reaction. For our annealing reaction, we conducted two parallel LIC reactions:

Reaction	Concentrations
Reaction 1	2 uL of insert LIC product + 10 uL of vector LIC product + 8 uL Molecular grade H2O
Reaction 2	5 uL of insert LIC product + 10 uL of vector LIC product + 5 uL Molecular grade H2O

Transformation of the Recombinant Vector Into DH5-alpha

Once the recombinant vector was successfully annealed, the vector had to be transformed into DH5-alpha E. coli cells as an experimental transformation before transformation into cells that would be used for protein expression. Two different reactions were set up in order to increase the chances of transformation success. The difference between the two reactions was the volume of the gene of interest used for annealing. Both reaction samples sat on ice for 30 minutes, were heat shocked at 42°C, incubated at 37°C for one hour, centrifuged, and resuspended in remaining LB broth. Two different ampicillin agar plates were set up, in which 200 uL of a reaction was plated. After overnight incubation at 37°C, both plates showed successful growth of colonies, indicating that the transformation of the recombinant vector in DH5-alpha E. coli cells was successful.

Verifying Gene Insertion Into the Vector

We selected three colonies from each of the post-LIC transformed DH5-alpha plates.

Reaction 1: Samples 1D, 1E and 1F.

Reaction 2: Samples 2D, 2E and 2F.

We performed a restriction digest analysis using enzymes xho1 and BamH1. The figure below shows the gel electrophoresis result of the restriction digest.

From the results we concluded that only one of the two restriction enzymes used for the digest functioned and linearized the vector. Since the bands of samples 1E and 1F were around 7-8 Kb, we concluded that these samples contain our recombinant plasmid. Well 1 contained 4 uL 1 Kb plus ladder, Well 2 contained the plasmid before restriction digest, Wells 3-8 contained samples 1E-2F.

To verify that samples 1E and 1F contained our recombinant plasmid, we used T7 forward and reverse primers to run a PCR amplification over the multiple cloning site. The amplicon resulting in a band around 2 Kb would indicate successful cloning of our insert into the vector. The figure below shows the results of PCR amplification.

As evident from figure 5, sample 1E generated an amplicon of size between 2-3 Kb and contained our recombinant vector. This indicates that the Protein S gene was successfully cloned into the pET His6 LIC cloning vector (2Bc-T).

Sequencing of the Recombinant Vector

In addition to utilizing the gel to confirm the recombinant vector, the following image displays the sequencing result that was performed using the T7 forward primer. The NCBI BLAST tool was used for pairwise alignment of the sequenced DNA vs protein S insert sequence. The percent match of 97.37% indicates that the gene was successfully inserted into the vector.

The following image displays the sequencing result of the recombinant vector using the T7 reverse primer. The percent match of 95.72% indicates that the gene was successfully inserted into the vector.

DNA sequencing of our recombinant vector using the T7 forward and reverse primers confirm successful cloning of our insert into the Multiple Cloning Site of the vector using ligation independent cloning (LIC).

Transformation into E. coli Cell Strains for Prokaryotic Expression

For selecting the optimal expression strains, we transformed our recombinant vector into four different E. coli strains: Bl21, Origami B (DE3), Origami 2 (DE3) pLysS and Origami 2 (DE3). Recombinant vector was transformed into these four cell strains which were then inoculated in 1 mL of LB broth and placed in an incubator shaker at 37°C, 220 rpm for 1 hour. 150 uL from each cell culture were plated and the results are as follows:

We observed recombinant colonies on the transformation plates of Bl21 and Origami B cell strains. No colonies were observed for Origami S and Origami X (2) transformation plates. Colonies were selected from Bl21 and Origami B transformation plates for conducting recombinant expression tests.

Detection of Protein Expression From the Selected Bacterial Strains

We conducted two expression tests to confirm production of recombinant protein S in the transformed cell strains: E coli. BL21 and origami B cells. For the first expression test, we picked colonies from the transformation plates containing our recombinant vector, cultured them in 5 mL LB and ampicillin overnight at 37°C, and used 125 mL of the overnight culture to dilute it into a 25 mL culture. Both the 25 mL cultures of Bl21 and origami B cells were grown to OD600 at 37°C and induced using 1 mM IPTG. A pre-induction sample was obtained from both cultures before induction. After induction, the cultures were grown for 4 hours at at 37°C and 220 rpm, and a post-induction sample was obtained every hour post-induction for 4 hours. All the expression samples were spun down at 3000 rpm for 5 min to harvest the cells, the supernatant was discarded, and the pellet was stored for conducting the expression tests. Below are the results of the SDS-PAGE and the western blot of our expression test:

Well #	Sample
Well 1	Ladder
Well 2	Origami B - Pre-Induction
Well 3	Origami B - 1 hr Post-Induction
Well 4	Origami B - 2 hr Post-Induction
Well 5	Origami B - 3 hr Post-Induction
Well 6	Origami B - 4 hr Post-Induction
Well 7	BL21 - 1 hr Post-Induction
Well 8	BL21 - 2 hr Post-Induction
Well 9	BL21 - 3 hr Post-Induction
Well 10	BL21 - 4 hr Post-Induction

Well #	Sample
Well 1	Ladder
Well 2	Origami B - Pre-Induction
Well 3	Origami B - 1 hr
Well 4	Origami B - 2 hr Post-Induction
Well 5	Origami B - 3 hr Post-Induction
Well 6	Origami B - 4 hr Post-Induction
Well 7	BL21 - 1 hr Post-Induction
Well 8	BL21 - 2 hr Post-Induction
Well 9	BL21 - 3 hr Post-Induction
Well 10	BL21 - 4 hr Post-Induction
Well 11	Ladder

However, the first expression test was not entirely conclusive. There was no expression from BL21 as indicated by the western blot results. Furthermore, the bands produced for Origami B expression samples were of incorrect size. Protein S is about 70 kD and the bands on the Western blot were around 30 kD. From the first expression test, it was concluded that BL21 is unable to express protein S as it might not be able to form the necessary glycosylations and disulfide bonds, which would result in the protein being insoluble and aggregating in the cells. The incorrect size bands of the Origami B protein sample indicates that the protein is being degraded after expression, which can be as a result of expressing at 37°C and inducing with 1 mM IPTG.

Optimizing Protein Expression

After consultation with advisors, we decided to perform another expression test on origami B cells. To optimize the expression, the origami cells were induced at 37°C and the temperature was gradually reduced to 23°C and induced using 0.5 mM, instead of 1 mM like in the first expression test. Two origami samples at different cell concentrations were also induced in parallel. Moreover, the induction samples were also sonicated (to lyse the cells) for 1 minute and protease inhibitors were added before performing the western blot.

Sample Ori 2 was induced at OD = 0.4 and sample Ori 3 was induced at OD = 1.1. The one pre-induction sample was collected from both Ori 2 and Ori 3 before inducing with 0.5 mM IPTG and 4 post-induction samples at an increment of 1 hour. Sample Ori 2 was expressed for about 16 hours and ori 3 for about 12 hours to collect overnight induction samples.

The following image shows western blot results for the second expression test:

Well setup is as follows:

As evident from Figure 14, the HRP anti-His 6 antibody successfully detected protein S target band (full length, about 70 kD) by Western blot. The level of expression can be seen increasing with time for sample Ori 3. As expected, the ability of origami B cells to make disulfide bonds and ensure proper folding, greatly enhances protein stability and prevents degradation as opposed to the BL21 strain. Moreover, the multiple bands visible from about 30-50 kD indicates that the protein is still being degraded from the N-terminal, since we have detection of the 6XHis-tags from the C-terminal. Protein S has multiple N-linked Glycans added as a part of its post-translational modification, which might have protective functions for the EGF domains and the disulfide bonds. The inability of our prokaryotic expression system to introduce glycosylations might be responsible for the degradation of the protein. We believe that expressing glycosyltransferases in both bacterial and yeast cell lines is a promising avenue for future research and a first step in increasing the resemblance of the in-cell produced protein S to human protein S.

---

Eukaryotic Expression (SF9)

In order to develop SF9 baculovirus expression system for recombinant protein S production, we planned on constructing a recombinant transfer vector pFastBac-YMBac-II, which would involve cloning our insert into the MCS of this vector, which is within the transposon segment (mini-attTn7). We planned on inserting our gene of interest into the MCS of the plasmid such that we have an RsrII restriction site just upstream of our insert and a TEV protease site, a twin-strep tag and 6X His-tag downstream of our insert. The sequences of our plasmid and the gene of interest used to design primers for the LIC reaction were highly GC rich, and we had to undergo several cycles of testing and improvement to optimize PCR conditions for our gene and the plasmid. After optimizing the conditions for PCR, we tested multiple conditions to optimize the Insert to vector ratio and concentrations for the LIC reaction.

Amplification of the Gene of Interest and the Plasmid

Our initial step was to amplify our GOI and plasmid using the primers we designed for generating 5’ overhangs after the T4 polymerase check back step for the Ligation Independent Cloning reaction. For this PCR we used an annealing temperature of 55°C.

As evident from figure 15, the gene of interest had been successfully amplified, however, there was significant laddering for the plasmid, which can be a result of non-specific annealing of the primers. Therefore, we decided to further optimize our PCR conditions.

Testing Multiple Annealing Temperatures for the Gene of Interest and the Plasmid

We changed the PCR conditions for the plasmid by increasing the extension time from 2 to 2.5 minutes and the final extension time from 2.5 to 5 minutes. We redid the PCR on our plasmid at 2 different annealing temperatures: 55°C and 62°C.

We decided to further optimize the PCR conditions as we could still observe some laddering on the gel, which might have been a result of the non-specific annealing of the primers.

For the next cycle of the PCR, we tried annealing temperatures of 66°C and 72°C for both the gene of interest and the plasmid.

The results of this PCR cycle indicated that lower annealing temperatures are preferable for both the GOI and the plasmid. Moreover, we decided to use GC enhancers for setting up the PCR reaction samples for both the GOI and the plasmid, with the hope of reducing non-specific annealing and improving the quality of the PCR amplified products.

For the next cycle of PCR, we decided to run a PCR on the GOI at annealing temperatures of 55°C and 60°C and test the PCR products of both, with and without adding the GC enhancers. Similarly, we decided to use annealing temperatures of 55°C and 62°C for the plasmid and test the PCR products of both, with and without adding the GC enhancers.

The results of this PCR cycle indicate that the optimal condition for the plasmid’s PCR reaction is an annealing temperature of 62°C and no GC enhancer present. All the bands for the GOI were very faint, which we concluded was because of the low concentration of DNA used for the PCR.

We re-did PCR on the GOI using an annealing temperature of 55°C, which according to our first PCR cycle, showed the best amplification for the GOI.

Despite trying a range of annealing temperatures, extension and final extension times during PCR and addition of GC enhancers, we were not able to significantly reduce the laddering effect seen on the gels. Therefore, we decided to use the best PCR conditions for the GOI and the plasmid, that we derived through many cycles of testing and learning, and performed gel extractions to obtain pure samples that could be used for the Ligation Independent Cloning reaction.

---

Optimizing Conditions for the Ligation Independent Cloning Reaction

We tested different ratios and concentrations of the insert and the vector for the LIC reaction. For the LIC reaction, we followed the protocol used by Douglas Marr, from Dr. Michael Airola’s lab at Stony Brook University.

---

LIC Attempt 1

Using the following calculator, we calculated the amount of insert and vector DNA we needed to use for the LIC reaction.

We used a ratio of approximately 3:1 (Insert:Vector), and about 38 ng of the insert vs 14 ng of the vector.

We mixed 2 uL of the vector LIC product and 2 uL of the insert LIC product, vortexed it and let it sit at room temperature for 10 minutes before transforming into E. coli NovaBlue cells and plating them.

No colonies were observed on the experimental plate, but several colonies on the positive control plate (just the intact vector pFastBac-YMBacII).

LIC Attempt 2

For the next round of the LIC reaction, we decided to increase the concentration of the insert and the vector used for annealing. We used a ratio of approximately 3:1 (Insert : Vector), and about 142 ng of the insert vs 47 ng of the vector. Moreover, we used E. coli DH5alpha for transformation. We used 5 uL of the insert LIC product + 5 uL of the vector LIC product and diluted it using 10 uL of ddH₂O making a total volume of 20 uL for transformation. We used the linearized plasmid pFastBac as a negative control.

No colonies were observed on either the experimental or negative control plates.

LIC Attempt 3

After consulting with our advisors, Douglass Marr and Andrew Sillato, we decided to increase the final concentrations of the insert and vector to 20 ng/uL in the 20 uL LIC reaction mix. Therefore we used 400 ng of both the insert and the vector for this round of LIC reaction. We used a ratio of 1:1 (Insert : Vector), and about 400 ng of both the insert and the vector. We mixed 5 uL of both the insert and the vector LIC products, vortexed and let it sit at room temperature for 30 min for the annealing to occur. We transformed the LIC mixture into DH5alpha and plated the cells after 1 hour of incubation.

As expected, no colonies were observed on the negative control plate (linearized plasmid pFastBac). However, we observed some colonies on the experimental plate. We picked 2 colonies (circled using a blue marker) to perform a colony PCR analysis.

Colony PCR Analysis

Well #	Sample
Well 1	DNA ladder
Well 2	Colony 1 (Original Primers, Tm = 62°C )
Well 3	Colony 1 (Control Primers, Tm = 55°C )
Well 4	Colony 2 (Original Primers, Tm = 65°C )
Well 5	Colony 2 (Control Primers, Tm = 55°C )
Well 6	Control Plasmid

According to Figure 22, Colony 1 seemed to have our recombinant vector, as we could see bands of approximately 2 kB size, which matched with the weight of our insert ~ 2kB. However, we were unable to grow colonies from the successful DH5alpha transformation plate. We decided to discontinue our lab efforts on the SF9 expression aspect of our project because of time constraints and diverted our entire focus and resources on the E. coli expression aspect of our project. Results from the colony PCR indicated presence of the recombinant vector in Colony 1, however, we decided that this alone was not a definitive proof of successful cloning, as we had to discontinue our lab experiments for SF9. We were successful in optimizing the PCR conditions for our GC rich insert and plasmid sequences, and possibly also optimized conditions for the Ligation Independent Cloning.

---

Conclusion

Overall, our goal was to design two expression systems in SF9 and Escherichia coli that would prove effective in allowing us to produce our protein of interest, protein S. After hours of foundational work, the designs detailed on our design page allowed us to accomplish this. Our plasmids and the genetic circuits were chosen and engineered to be best-suited for our experiments. Moreover, we assessed the efficiency of our gene circuits by modeling them in MATLAB and used the analytical data to determine our wet lab experiments. We confirmed successful insertion of the PROS1 gene into the E. coli expression vector 2Bc-T by amplifying the insert site using PCR and verifying its correct size using gel electrophoresis. BL21 and origami cell transformants were used for expression tests and the results confirm protein S expression from origami B cells.

We were unable to carry on our wet lab experiments for SF9 expression systems because of the time constraint imposed due to the complexity of the baculovirus expression system. However, we believe that our protocols, experimental data, parts collection and mathematical modeling data for SF9 expression systems can be used and improved upon by future iGEM teams to achieve successful expression of recombinant proteins from the baculovirus system. We hope that all the data and documentation of our experimental design on this page, and on our parts page, will be extremely useful for future research and scaling up protein S production as a therapeutic approach. We hope future iGEM teams and researchers looking into this and similar issues, will be able to use our designs as a foundation for their work.

---

Discover