PROS by the Stony Brook University 2022 iGEM Team

Design

As mentioned on the description page, our project utilizes recombinant DNA technology for heterologous expression of the human protein S gene into host species that can express protein S with all the post-translational modifications and folding. Since we hope to pave the way for an injectable protein S medication for people with all types of protein S deficiencies, the host-expressed protein S must be as similar to the human protein S as possible. However, making an injectable protein S medication would involve commercializing protein S expression systems, making it essential for us to look for expression systems which are feasible for industrial-scale protein expression.

After a lot of research and consulting with advisors and experts in the field, we decided to use the baculovirus expression system for the SF9 insect cell line (Spodoptera Frugiperda) and E. coli strains, BL21 and origami B. SF9 being a eukaryotic cell line, is popular for the expression of human proteins and antibodies because of its ability to perform advanced post-translational modifications, which prokaryotic hosts like E coli are incapable of. However, cloning and expression using the baculovirus systems in SF9 cells includes multiple additional steps than the traditional bacterial expression systems and generates time constraints for successful completion of the project. Therefore, we decided to express protein S in E coli Bl21, origami B (DE3) and origami 2 (DE3) cell lines along with SF9 cells, which would provide us with comparative data between the efficiency and feasibility of protein production in eukaryotic vs. prokaryotic hosts.

On this page, we describe the rationale behind the design of the parts of our project. We believe that all of this data will be extremely useful for future research and scaling up protein S production as a therapeutic approach.

Genetically Modifying SF9 Cells for Protein Expression

Developing more and more effective systems for the production of recombinant proteins is crucial because of the role these proteins play in biochemical structural and functional studies, cancer research, drug design, production of human vaccines, etc..

Recombinant DNA technology has become widely used in modifying baculoviruses for heterologous gene expression in insect cells. Baculovirus expression systems have multiple benefits over using traditional bacterial expression systems and other eukaryotic expression systems:

Baculoviruses have a restricted host infection range, therefore, they are relatively safe to work with since they do not infect vertebrates.
Baculovirus protein expression is driven by a very potent and strong polyhedrin promoter, allowing for high levels of expression compared to other expression systems.
Baculovirus genome expresses heterologous genes while diminishing host protein expression. This makes protein recovery from infected cells easier.
Moreover, insect cells can be infected with baculoviruses containing two or more gene expression circuits or simultaneously infected with multiple viral genomes containing different gene expression circuits. This allows for expression of multiple proteins in a single infection cycle.
Baculoviruses are not limited by the size of the protein they can functionally express. Baculoviruses infection of insect cells can achieve recombinant proteins with accurate post-translational modifications, resembling proteins secreted in higher eukaryotes, including humans.

Recombinant baculoviruses are generated containing a heterologous protein expression gene and are used to infect insect cells. The infection cycle begins in the nucleus of insect cells, where viral transcription is initiated using the host cell expression machinery. As all the necessary viral proteins are produced, the host genome expression is silenced and cellular resources are allocated towards viral replication and the production of recombinant proteins.

The infection cycle can be divided into early, late and very late phases. These phases are categorized based on the genes being expressed and hours post infection (hpi).

Early phase: Expression of the first viral genes can begin as early as 30 minutes post-infection. These genes mostly encode transcriptional activators and other important regulatory proteins involved in viral replication. These genes are transcribed using host RNA polymerase.

Late phase: Begins around 6 to 15 hpi and is marked by a reduction in host gene expression and initiation of viral replication. Viral genes expressed in this phase are transcribed by the baculovirus RNA polymerase. The majority of the viral genes expressed encode for viral nucleocapsid and other structural proteins, which are critical to the budding of produced viruses.

Very Late Phase: Begins around 18 hpi and continues through 72 hpi. Nearly all host gene expression is silenced allowing for rapid bursts of viral gene expression. Genes expressed in this phase encode proteins that promote formation of viral occlusion bodies. Two important genes expressed are p10, which assists in the maturation of occlusion bodies and host cell lysis and polyhedrin, which forms the protective coat of the viral particles.

Here, we highlight the Bac-to-Bac expression system developed by researchers at the Monsanto Company, an American agrochemical and agricultural biotechnology corporation. We decided to use the Bac-to-Bac expression system for expressing recombinant protein S in SF9 cells.

Traditional Baculovirus expression systems utilize homologous recombination to introduce foreign genes into the parent viral genome. This is inefficient because the frequency of recombinant progenies generated as a result of homologous recombination is typically just 0.1 to 1%, which can be increased to 80% or higher, but that requires multiple steps in linearizing and editing viral genomes. However, the Bac-To-Bac baculovirus expression system utilizes site-specific transposition of foreign gene expression circuits into a baculovirus genome (bacmid), which is propagated in E. coli DH10Bac cells. Bacmid DNA usually contains a kanamycin resistance gene and a lacZα coding DNA segment. The N-terminus of the lacZα gene contains a short segment (does not disrupt the reading frame of lacZα) , which serves as the attachment site for the bacterial transposon Tn7 or mini-attTn7 segment.

The initial step in generating recombinant bacmids is to clone the desired insert between the mini Tn7 elements of the mini-attTn7 segment in a pFastBac donor plasmid. Then our insert (Part:BBa_K4235000), flanked by mini Tn7 elements upstream and downstream can be transposed from the pFastbac donor plasmid to the mini-attTn7 attachment site on the bacmid. The transposition function is provided by a helper plasmid already present in the E. coli DH10Bac cells, which expresses the enzyme transposase. Successful insertion into the bacmid will disrupt the expression of the lacZα coding segment. This allows for blue-white screening of successful recombinant bacmids using X-gal. Subsequent steps include isolating the recombinant bacmids, propagating, transfecting insect cells, protein expression and purification.

We received the baculovirus transfer vector pFastBac as a kind donation from the Airola lab at Stony Brook University. pFastBac is used for the expression of 6x His-TEV-tagged proteins in insect cells through the Bac-to-Bac baculovirus expression system. The main components of this vector are an Ampicillin resistance marker gene and a mini-attTn7 transposon segment, which contains the multiple cloning site for expressing recombinant proteins driven by the polyhedrin promoter, a SV40 polyA signal and a Gentamicin resistance gene expressed from the pC promoter. The mini-attTn7 segment is flanked by terminal inverted repeats called Tn7-L and Tn7-R which are recognized by the enzyme transposase. Transposases are responsible for introducing double-stranded breaks at these mini Tn7 elements and freeing the DNA sequence from the transfer vector. This DNA segment can then be inserted/transposed into another bacterial or baculovirus genome propagated in E coli DH10Bac cells, allowing for the production of recombinant Bacmid particles.

The vector pFastBac was modified by the Airola lab at Stony Brook University to have twin strep tags and a 6x His-tag with a TEV site on the C-terminal of the MCS instead of N-terminal, as found in the original pFastBac HT-B.

For our project, we intended on cloning our insert just upstream of the twin strep tag and 6x His-tags which are on the C-terminal of the MCS in YmBac-II, using ligation independent cloning (LIC).

Ligation Independent Cloning

Ligation independent cloning is a technique alternative to traditional restriction enzyme cloning, which involves producing short homology arms/overhangs on the cloning substrates using PCR amplification. Vectors can be linearized using PCR primers or a restriction enzyme. For cloning into the pFastBac transfer vector, we used two primers for linearizing the plasmid, which are attached to the 3’ and 5’ ends of the vector. Complementary primer sequences are used to amplify the insert for the cloning reaction. LIC exploits the dual polymerase - exonuclease activity of the T4 polymerase. The insert is treated with just dATPs and T4 polymerase, which chews back the 3’ ends until it reaches a T. Upon reaching a 3’ T, T4 polymerase gets stalled and switches its action to polymerase as it starts constantly adding dATP. Similarly, the vector is treated with just dTTPs and T4 polymerase. This treatment step produces DNA constructs with 5’ overhangs that can anneal to one another in the final annealing reaction.

Primer Design for LIC

The following primers were used to PCR amplify the insert and the vector and to add the extra sequence designed for this particular LIC reaction.

Insert Forward Primer : CCAGCGGCGGT GCCACCATGAGGGTC
Insert Reverse Primer : GAGCCCGAGGAGCT AGAATTCTTTGTCTTTTTCCAAAC

Vector Reverse Primer : CCGCCGCTGGA GGTTTCGGACCGAGATC
Vector Forward Primer : GCTCCTCGGGCTCA GGTACCGATTACGATATCCC

LIC Procedure

Genetically Modifying E. coli Strains BL21 and Origami for Protein Expression

For transforming both E coli strains we decided to use the expression vector pET His6 (2Bc-T) [https://www.addgene.org/37236/] , which contains ampicillin resistance, an IPTG inducible T7 promoter and a C-terminal 6x His tag downstream of the MCS. For cloning our insert into this vector, we used a similar LIC protocol to generate complementary overhangs on the insert and vector for the annealing reaction.

The pET His6 LIC cloning vector (2Bc-T) was provided to the Stony Brook iGEm team as a generous donation from the Glynn lab at Stony Brook University.

The vector has a LIC site which is acted upon by the restriction enzyme Hpa1 to linearize the vector. LIC exploits the dual polymerase - exonuclease activity of the T4 polymerase. For this LIC reaction, the insert is treated with just dGTPs and T4 polymerase, which chews back the 3’ ends until it reaches a C. Upon reaching a 3’ C, T4 polymerase gets stalled and switches its action to polymerase as it starts constantly adding dGTP. Similarly, the vector is treated with just dCTPs and T4 polymerase. This treatment step produces DNA constructs with 5’ overhangs that can anneal to one another in the final annealing reaction.

Primer Design for LIC

The following primers were used to PCR amplify the insert and the vector and to add the extra sequence designed for this particular LIC reaction.

Insert 5’ : Forward primer: TTTAAGAAGGAGATATAGTTCATGCGCGTACTTGGCGGACGC
Insert 3’ : Reverse primer: GGATTGGAAGTAGAGGTTCTCAGAGTTCTTAGTTTTTTTCCAAACTG
Vector 5’ : 5'TTTAAGAAGGAGATATAGTTC(ATG)3'
Vector 3’ : 5'GGATTGGAAGTAGAGGTTCTC3'

We successfully cloned our insert into the LIC vector using this protocol and transformed into E coli Bl21 and origami B strains for expression tests (see the results page for more details).

Optimization of Bacterial Expression

To determine the appropriate system for expressing Protein S, we transformed our recombinant vector into both Bl21 and origami B strains and examined IPTG induced expression in both systems. Protein S is a soluble protein and undergoes many post-translational modifications like glycosylations and disulfide bonds to enable proper folding before being secreted extracellularly. Generally, bacterial expression systems are not optimal for secretion of proteins with eukaryotic post-translational modifications and foldings. However, Origami B is an expression strain derived from a LacZY mutant of Bl21 and contains mutations in thioredoxin reductase (trxB) and glutathione reductase (gor) genes. These mutations greatly enhance their ability to make disulfide bonds which prevents protein degradation and increases protein stability. Origami 2 (DE3) and Origami 2 (DE3) pLyS cell strains are K-12 derivatives with the same mutations as Origami B, but are also kanamycin selective. The pLysS designation means that the cells carry a plasmid encoding T7 lysozyme, which lowers the background expression (before IPTG induction) from genes under the control of the T7 promoter. We plan to do parallel induction studies in Bl21 and Origami strains, manipulating expression conditions like the concentration of IPTG used for induction and temperature, to determine optimal conditions for expressing protein S from bacterial systems.

References

Chen, X., Wu, J., Liu, H., He, Z., Gu, M., Wang, N., Ma, J., Hu, J., Xia, L., He, H., Yuan, J., Li, J., Li, L., Li, M., & Zhu, X. (2010). Approaches to efficient production of recombinant angiogenesis inhibitor rhVEGI-192 and characterization of its structure and antiangiogenic function. Protein science : a publication of the Protein Society, 19(3), 449–457. https://doi.org/10.1002/pro.323

Bac-to-bac baculovirus expression systems . (n.d.). Retrieved September 22, 2022. http://wolfson.huji.ac.il/expression/bac.pdf

The Wolfson Centre for Applied Structural Biology. (n.d.). Bacterial Strains for Protein Expression. Bacterial strains for protein expression. Retrieved September 27, 2022, from http://wolfson.huji.ac.il/expression/bac-strains-prot-exp.html.