Notebook

Our laboratory notebook

Monday July 11th 2022

TAP and TAP agar media preparation (Tris-minimal medium) :

  • Tap medium for 1 L (adjust final pH to 7.0 with HCl) :
    1M Tris base (e.g. Trizma) 20mL
    Phosphate buffer II  1.0mL
    Solution A  10.0mL
    Hutner’s trace elements 1.0mL
    Glacial acetic acid  1.0mL
    ‍
  • Phosphate buffer II (for 100mL) :
    K2HPO4  10,8g
    KH2PO4 5,6g
    ‍
  • Solution A (for 500mL) :
    NH4Cl  20g
    MgSO4 7H20 5g
    CaCl2 2H2O  2,5g
    ‍
  • For TAP-agar : 15g/L agar

PCR on p0-260 in order to get pPSAD in A2-B1 position :

PCR on p0-260 pPSAD + 5’UTR with the GG147 / GG191 primers in order to get an insert of the pPSAD promoter in A2-B1 :

  • GG147 : ttgaagacaactcatgacCACACACCTGCCCGTCTGCC
    (PPSAD+5'UTR_PSAD_A2_Fw)
    ‍
  • GG191 : TTGAAGACAACTCGATGGGGCTTGTTGTGAGTAGCAGTGGGG 
    (PPSAD+5'UTR_PSAD_B1_Rv)
    ‍

The concentration of p0-260 was 100,4ng/µL and the PCR product expected to get 850bp.

Tuesday July 12th 2022

PCR on p0-260 in order to get pPSAD in A2-B1 position :

From a solution of p0-260 at 100,4 ng/µL, we made a dilution in order to have a concentration at 2 ng/µL
→ Dilution of p0-260 : 40 µL of water + 0,8 µL of sample.
The PCR product is expected to get 850bp.

This time, we also did a negative control with 1 µL of water instead of 1 uL of template DNA

PCR on THB1 in order to have THB1 in B3-B5 position :

The concentration of THB1 was 51,7 ng/µL and the PCR product expected to get 458 bp.

We also did a negative control with 4 µL of water instead of 4 uL of template DNA.

Both PCRs didn’t work, probably because of an experimental handling error.

Tuesday July 19th 2022

PCR on p0-260 in order to get pPSAD in A2-B1 position

We also did a negative control with 4 µL of water instead of 4 µL of template DNA.

The band obtained is lower than expected. We have to redo the experiment.

PCR on THB1 in order to have THB1 in B3-B5 position

We also did a negative control with 6 µL of water instead of 6 µL of template DNA.

Wednesday July 20th 2022

Because we couldn’t succeed to do a proper PCR on p0-260, we decided to change the plasmid and use p001 instead.

PCR on p001 in order to get pPSAD in A2-B1 position :

From a solution of p0-001 at 224 ng/µL, we made a dilution in order to have a concentration at 2 ng/µL.
→ Dilution of p0-001 : 50 µL of water + 0,45 µL of sample.
The PCR product is expected to get 850bp.

We also did a negative control with 4 µL of water instead of 4 µL of template DNA.

Result of the PCR on THB1

This morning, we verified the PCR result on THB1 that we did yesterday with an electrophoresis.

Extraction, Purification and Dosage :
We wanted to extract 30 ng/uL of THB1 from the agarose gel 
But after the purification, we only got 1,3 ng/uL
→ we need to do it again by changing some parameters

PCR on THB1 in order to have THB1 in B3-B5 position

Thursday July 21th 2022

Extraction, Purification and Dosage for the PCR on P001.

The blank was made with Buffer NE

Friday July 22th 2022

MoClo of pPSAD A2-B1 with pAGM9121 :

The software gives the volume to use based on the concentration measured on the Nanodrop.

The volumes of those two tubes are 14 µL. Plus the ligase mix of 6 µL, the final volume is 20 µL.

Then, we do a PCR with these parameters, without the final step (20 min at 65°).

Transformation of E.coli with p0-pPSAD :

We take 25 µL of competent E.Coli (stored at -80°) and add 4 µL of ligation product (p0-pPSAD) :
15 minutes on ice / 45 secondes at 42°C / 10 min at 4°C.
We add 500 µL of LB breth.
centrifugation : 600 rpm at 37°C for 1 hourthrow away the supernatant, then centrifuge at 400 g for 2 minutes.
Spread out on a petri dish of LB Xgal+Ampicilline (100-200µL) : Incubate overnight at 37°C.
‍
The bacteria with the plasmid containing the insert appears white.
‍

Monday July 25th 2022

For this gel, we used TAE instead of TBE and the electrophoresis chamber already contained some TBE so the gel didn’t work.

Transformation of E.coli with p0-pPSAD :

3 mL LB
3 µL antibiotic Spec (1000X → 1X)
In each tube, we put one white colony of E.coli. Then, the tubes are placed in the agitator at 37°C overnight.

PCR on THB1 in order to have THB1 in B3-B5 position :

We also did a negative control with 4 µL of water instead of 4 µL of template DNA.

The PCR machine failed during the first step but we decided to continue the experiment anyway. Unfortunately, the gel didn’t work.

Tuesday July 26th 2022

Mini prep of p0pSAD :

Purification :
‍

  • Centrifugation of the E.coli colonies (4000 g for 3 min)
  • Throw away the supernatant in a tube “LB waste”
  • For the cellular lysis : Add 250 µL of buffer A1 (in the fridge, contains the RNase) to resuspend and then put the mix into a 1,5mL Eppendorf tube. Add 250 µL of buffer A2, mix the tube by reversing it, wait 5 min at room temperature. Add 300 µL of buffer A3, mix the tube by reversing it until the blue color is gone.
  • Centrifugation of the lysate (11000 g for 5 min)
  • Bind DNA : Place the column into a collection tube of 2mL. Put 700 µL (maximum of capacity) of supernatant in the column. Centrifugation at 11000 g for 1 min. Throw away the content of the collection tube into a tube noted “Chemical waste”. If there is more than 700 µL, repeat these steps with the same column.
  • Washing : Add 500 µL of buffer AW (this buffer needs to be heated at 50°C!). Centrifugation at 11000 g for 1 min. Add 600 µL of buffer A4. Centrifugation at 11000 g for 1 min. Throw away the content of the collector tube into the “Chemical waste” tube.
  • Drying of the column : Centrifugation at 11000 g for 2 min. Throw away the collector tube after emptying it.
  • Elution : Place the column into a 1,5mL Eppendorf tube. Add 50 µL of elution buffer and wait 1 min at room temperature. Centrifugation at 11000 g for 1 min

Digestion :
‍
We measured the concentration of our tubes with the Nanodrop. We did a blank of 1,5 µL elution buffer. All our tubes have a concentration around 30 ng/µL so they are usable for digestion.

PCR on THB1 in order to have THB1 in B3-B5 position :

We also did a negative control with 8 µL of water instead of 8 µL of template DNA.

Wednesday July 27th

Digestion :

Same process as before but this time we used the BsaI enzyme and did a control with the plasmid PAGM9121 (in the 2nd slot).
‍

PCR on THB1 in order to have THB1 in B3-B5 position :

We used 3 times the quantities listed above in the table. We sorted these quantities in 3 tubes : one containing 50 µL and two containing 25 µL. We’ve also made a control without DNA. We added 10 µL of 6X loading purple in the 50 µL PCR mix tube and 5 µL in the 25 µL PCR mix tube.

In the following blot :
Well 1 :O'GeneRuler 1 kb Ladder (4 µL)
Well 2 (takes up the equivalent of two spaces/wells): control = no DNA (20 µL)
Well 3 (takes up the equivalent of two spaces/wells): 60 µL of the PCR mix
Well 4 : 20 µL of the PCR mix

Friday August 5th

PCR on p0-006 in order to get tPSAD in B6 position :

From a solution of p0-006 at 131 ng/µL, we made a dilution in order to have a concentration at 4 ng/µL.
The PCR product is expected to get 584 bp.

We also did a negative control with 5 µL of water instead of 5 µL of template DNA.

Monday August 8th

Migration of p0-006 PCR product on agarose gel and purification

Purification  of tPSAD :  29 ng/µL (ratio of 0,69). 
It may have interferences because there was ten times the normal amount of  BET in the gel, and the final volumes of PCR product between the control and the sample were different.

We also did a negative control with 5 µL of water instead of 5 µL of template DNA.

Tuesday August 9th

MoClo reaction between the PCR product of tPSAD and the backbone pAGM9121

MoClo level 0. The objective is to get tPSAD in B6 position in order to make our test construction with the insulator sequence.

Order of THB1 and Atgypsy in A1 and C1 on Twist Bioscience

Indeed, we were not able to do PCR on genomic DNA with such primers (with a long floating tail, because of the restriction and fusion sites), so we had to order them on Twist Bioscience.

PCR on p0-35 in order to get mVenus in B2-B5 position

PCR product should be around 800 bp.

PCR de vérification des constructions de niveau 0 mVenus et tPSAD

In order from left to right: mVenus(B2-B5) 1 to 3 and tPSAD(B6) 1 to 3 digested by BsaI; and finally the 1kb+ ladder.

Expected size for mVenus: 815 bp.
Expected size for tPSAD: 564 bp.

Monday August 22th

Liquid culture of chlamydomonas reinhardtii ( V = 50 mL) for culture experiments. All cells were cultured in light-exposed conditions, under Xg of agitation and at 20°C.

Tuesday August 23th

We received THB1 aligned primers (forward and reverse).
We added :
- 513 uL of water for THB1_align_FW
- 466 uL of water for THB1_align_RV
From this solution of primers at 100 ug/L, we made a dilution in order to have a concentration at 10 ug/L.
→ 90 µL of water + 10 µL of sample

PCR on THB1 in order to have THB1 in B3-B5 position

We also did a negative control with 8 µL of water instead of 8 µL of template DNA.

Friday September 9th

Inoculation of UVM4 strain of Chlamydomonas reinhardtii from solid TAP-agar to 100mL of liquid TAP. All cells were cultured in light-exposed conditions, under Xg of agitation and at 20°C.

Friday September 21th

Inoculation of 2 cultures of UVM4 strain of Chlamydomonas reinhardtii from 1 mL and 0.5 mL of September 9th’s culture. All cells were cultured in light-exposed conditions, under Xg of agitation and at 20°C.

Friday September 30th

Inoculation of 100mL of TAP media with 1/100th and 1/10th dilutions of September 9th’s cultures. All cells were cultured in light-exposed conditions, under Xg of agitation and at 20°C.

Standard TAP media composition

100mL of 7 TAP media were prepared, deviating from the standard recipe in the following ways :
- 1 did not differ from the recipe
- 1 had no acetate in the recipe
- 1 halved the normal amount of acetate in the recipe (9.15 µM)
- 1 doubled the normal amount of acetate in the recipe (36.6 µM)
- 1 with 0.1 µM of iron added to the final iron content (0.18 µM + 0.1 µM = 0.28 µM)
- 1 with 0.25 µM of iron added to the final iron content (0.43µM)
- 1 with 20 µM of iron added to the final iron content (20.18 µM)

Monday October 3rd

Cell count was determined from 30/09’s cultures using a X cell-counter reading red fluorescence from XXX :
- d10 numbered 1.59*10^7 cells/mL
- d100 numbered 6.13*10^6 cells/mL

Triplicates of 30mL of each TAP media prepared on September 30th were inoculated with 8.16 µL of the d100 culture, as to have an initial concentration of 0.5*10^5 cells/mL.

Each triplicate was then installed in a bioreactor for culture over a week in different conditions, that can be recapped in the following table :

All cells were cultured under Xg of agitation and at 20°C.
Day corresponds to light-exposed growth conditions and night to dark growth conditions

Friday October 7th

Partial growth curve data downloaded from bioreactor and transmitted to the modeling team. Culture to continue over the weekend under the same conditions.

Tuesday October 11th

End of cell culture after ≈ 192 hours and transmission of photobioreactor measurement data to modelling team.