Experiments

1. Primers

DexA-F	GTTTCGCTACCGTTGCGCAAGCTCAAAAGAATGGCAACATGATA
DexA-R	TTATTTGATGCCTGGCTCTAGTATCAGTGGTGGTGGTGGTGGTGC
Puc57-F	TACTAGAGCCAGGCATCAAAT
Puc57-R	AGCTTGCGCAACGGTAGCGAAAC

2. System

DexA70:

DexA70	1 μL
DexA-F	1 μL
DexA-R	1 μL
PrimeStar	10 μL
ddH2O	7 μL

pUC57:

pUC57	1 μL
Puc57-F	1 μL
Puc57-R	1 μL
PrimeStar (2X)	10 μL
ddH2O	7 μL

3. Program:

Initial denaturation	95℃	5 min
Denaturation	95℃	5 s
Annealing	56℃	15 s
Extension	72℃	2 min 45 s
30 cycles
Final extension	72℃	10 min
	4℃	Infinite

Preparation of agarose gel:

1. Dissolve 1 g of agarose in 100 mL TAE buffer, microwave for 3 minutes until the mixture turns transparent;
2. Add 10 μL nucleic acid gel stain and mix them;
3. Pour the solution in slot and place the comb within the slot;
4. Wait for 30 minutes until the gel cools and solidifies.

Preparation of samples:

Sample	10 μL
DNA loading buffer	1.1 μL

Load samples:

1. Pour more TAE buffer in electrophoresis apparatus so that the liquid covers the whole gel
2. Load the samples in appropriate order (First two are markers)
3. Set the electrophoresis apparatus at 150 V for 30 minutes
4. Use UV to visualize the DNA strand

As shown in the graph above, DexA70 and pUC57 are amplified correctly.

System (total 20 uL):

Gbison enzyme (10x)	2 μL
buffer (5x)	4 μL
pUC57 plasmid	30 fM
DexA70 gene	60 fM
ddH2O

Process:

1. Measure the concentration of pUC57 plasmid and DexA70 gene through Nanodrop;
2. Use the measured concentration to calculate the amount of plasmid and DNA needed;
3. Based on the above system, add Gbison enzyme, buffer, pUC57 plasmid and DexA70 gene to a 200 μL tube, fill in double distilled water to reach 20 μL;
4. Put the tube in 37°C water bath for 30 min;
5. Store in 4°C refrigerator.

System (total 20 uL):

1. Take out E. coli DH5α competent cells from -80 ℃ refrigerator;
2. Add reconstructed plasmids for every 100 μL competent cells;
3. Ice-bath for 30 min;
4. Water-bath at 42℃ for 90 s, and immediately place it on ice for 3 min;
5. Add 500 μL liquid LB medium;
6. Shake culture at 37 ℃ for 1 hour;
7. Spread coat 100 μL of the mixture on the LB plate that has kanamycin (50 μg/mL);
8. Inverted culture at 37 ℃ for 12-16 hours.

Bacterial Cell Coating

Preparation:

1. LB with K⁺ to fill the petri dish;
2. DH5α E. coli used for transformation.

Process:

1. Take out the tubes in the shaking incubator and remove the liquid, leaving only the bacteria inside;
2. Mash and mix the bacteira, then transfer it into the petri dish with LB with K⁺;
3. Use a petri dish spreader to evenly spread the DH5α E. coli;
4. Put petri dishes in 37°C incubator for storage and cultivation.

1. Add 500 μL Buffer S into the absorption column (placed in the collection tube), centrifuge at 1200 xg for 1 min, remove the liquid in the collection tube;
2. Centrifuge 3 mL cultured DH5α at 8000 xg for 2 min. Collect the bacteria precipitate and remove the supernatant;
3. Add 250 μL Buffer SP1;
4. Add 250 μL Buffer SP2, flip upside down gently for 10 times. Place it at room temperature for 3 min;
5. Add 350 μL Buffer SP3, flip upside down gently for 10 times;
6. Centrifuge at 12000 xg for 10 min, and transfer the supernatant to the absorption column. Then Centrifuge at 8000 xg for 30 s, and remove the liquid in the collection tube;
7. Add 500 μL Wash Solution, centrifuge at 9000 xg for 30 s, and remove the liquid in the collection tube;
8. Repeat the last step once;
9. Centrifuge the empty absorption column at 9000 xg for 1 min. Place the absorption column at room temperature with the lid open for 3 min;
10. Place the absorption column in a new 1.5 mL centrifuge tube, add 50-100 μL Elution Buffer at the center of the absorption membrane, centrifuge for 1min, and store the liquid in the centrifuge tube.

Preparation:

1. 0.1 M CaCl₂ solution
   • weigh 1.11 g of CaCl₂ and add it to 100 mL water to;
2. 0.1M CaCl₂ solution with 15% glycerol
   • weigh 1.11 g of CaCl₂ and add it to 85 mL water and 15 mL glycerol;
3. 100 mL of E. coli 1917.

Process:

1. Prepare 2 tubes and add 50 mL of E. coli 1917 to each one, place both tubes on ice to cool down for 10 min;
2. 4°C 3000x centrifuge for 10 min;
3. Remove the supernatant and add 30 mL of 0.1M CaCl₂ solution to each tube, place both tubes on ice for 30 min;
4. 4°C 3000x centrifuge for 10min;
5. Remove the supernatant and add 2 mL of precooled 0.1M CaCl₂ solution with 15% glycerol to each tube;

subpackage 20 tubes each with 200 μL extractions, store in -80°C refrigerator.

1. Unfreeze E. coli 1917 competent cells;
2. Add plasmids and E. coli 1917 as the follow table;

   1917-pUC57-DexA70		1917-pUC57-DexA70+pUC57-ClyR		1917-pUC57
   DexA70	11 uL	DexA70	11 uL	pUC57	1 uL
   E. coli 1917	100 uL	ClyR	11 uL	E. coli 1917	100 uL
   		E. coli 1917	100 uL

3. Sitting on ice for 30 min;
4. Water bath in 42°C for 90 s;
5. Sitting on ice for 3 min;
6. Add 500 uL LB liquid culture medium;
7. Shaking for 1 hour under 37°C, 180 rpm.

1. Prepare the mixed solution of arabinose and double distilled water according to the concentration of 10 uM/Ul;
2. Use 0.45 um filter to filter the solution;
3. Add the arabinose solution to each transformed E. coli Nissle 1917 using the ratio of 3:1000;
4. Placed the transformed E. coli Nissle 1917 on shaker under 37°C, 220 rpm;

Buffer A	Na2HPO4	20 mM
	Imidazole	20 mM
	NaCl	500 mM
Buffer B	Na2HPO4	20 mM
	Imidazole	500 mM
	NaCl	500 mM

Process:

1. Prepare buffer A and B based on the concentration listed above, and add double distilled water to dissolve;
2. Use HCl to adjust the pH of both solutions to 7.4;
3. Use 0.45 um filter to filter the solution;
4. Add 10 mL buffer A to a clean absorption column, sit at room temperature for 10 min, and let it filter;
5. Take the transformed E. coli Nissle 1917 to centrifuge under 5000 rpm for 5 min, take the centrifugal supernatant;
6. Take about 100 uL of each to obtain the unpurified transformed E. coli 1917 supernatant;
7. Add the rest supernatant to the absorption column, let it sit for 2 min and then filter (repeat multiple times until all the supernatant are filtered; Collect the filtered solution to obtain the supernatant filtrate;
8. Add buffer A to wash impurity another several times;
9. Add 5mL buffer B, sit at room temperature for 2 min, and collect the purified protein.

Preparation of comparison glucose concentrations (20 mg/mL, 15 mg/mL, 10 mg/mL, 5 mg/mL, 0mg/mL)

1. Weigh 10 mg of glucose and mix with 500 μL water, mark 20 mg/mL;
2. Add 150 μL of 20 mg/mL solution and 50 μL water to new tube for 15 mg/mL solution;
3. Add 150 μL of 20 mg/mL solution and 150 μL water to new tube for 10 mg/mL solution
4. Add 150 μL of 10 mg/mL solution and 150 μL water to new tube for 5 mg/mL solution

Preparation of comparison glucose samples

Add 800 μL water, 100 μL 70.5 mg/mL Na₂HPO₄ solution, and 100 μL sample of each respective concentrations to make six samples of each concentration.

Preparation of experimental samples

1. Add 500 μL of E. coli 1917-pUC57 supernatant, E. coli 1917-DexA70 supernatant, E. coli 1917-DexA70 + E. coli 1917-ClyR supernatant respectively into separate sample tubes;
2. Add 100 μL 70.5 mg/mL Na₂HPO₄, 300 μL water, 100 μL 100 mg/mL glucan solution to each sample;
3. Prepare 5 of each sample, each marked with 6 min, 12 min, 18 min, 24 min, 30 min label for 5 groups of samples.

DNS testing of samples

1. Place plasmid samples into 37 °C water bath, remove a group every 6 minutes;
2. Take out 100 μL sample and mix with 200 μL DNS, place into 100°C water bath for 2 minutes;
3. Add 1.2 mL water;
4. Add 100 μL of each sample and place into 96-well plate;
5. Test plate under 520-540 nm wavelength colorimeter to test light absorption.