1. Aptamers were resuspended according to IDTE’s guidelines. Before opening the cap, the tube containing aptamers were briefly centrifuged to ensure the oligomers were pelleted at the bottom and minimize yield loss.
2. The aptamers were then resuspended in IDTE pH 7.5 (1X TE Solution) to 100 uM.
3. The stock solution was used to prepare desired concentration of aptamer by diluting in IDTE pH 7.5. All solutions were stored at -20° C.

1. Monomeric human Aβ stock solutions were prepared by solubilizing 1 mg of the peptide in 1mL of HFIP in a 1.5mL Protein LoBind tube (Eppendorf).
2. The resulting solution was vortexed and sonicated for 30 min in an ultrasonic bath filled with ice-cold MilliQ water to remove pre-formed aggregates.
3. The solution was aliquoted into 0.5mL Protein LoBind tubes containing 40 μL fractions each and dried carefully with a nitrogen gas by slowly rotating the tube. The resulting tubes with transparent peptide film were stored at -80 °C until use.
   in NaCl
   
4. For each trial, a fresh Aβ film was dissolved in ice-cold 4 mM NaOH solution and sonicated for 5 minutes in ice-cold MilliQ water to disrupt remaining aggregates. The concentration of the Aβ42 stock solution was determined by absorbance measurements at 280 nm (ε = 1280 M-1 cm-1 for tyrosine) using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA). The Aβ stock solution was kept on ice for the duration of the experiment.
   In DMSO
   
5. Aβ DMSO stock was prepared by adding 10 μL fresh dry DMSO to 0.225 mg Aβ42 peptide (2 μL to 0.045 mg Aβ42). *0.225 mg since we aliquoted 50 uL instead of 100 uL.
6. Pipette thoroughly, scraping down the sides of the tube near the bottom to ensure complete resuspension of peptide film.
7. Vortex well (~30 s) and pulse in a microcentrifuge to collect solution at the bottom of the tube
8. Sonicate 5 mM Aβ DMSO solution for 10 min in a bath sonicator.
9. The concentration of the Aβ42 stock solution was determined by absorbance measurements at 280 nm (ε = 1280 M-1 cm-1 for tyrosine) using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA).

1. Glass slides were soaked in soap water and rinsed briefly
2. The glass slides were dried under nitrogen flow.
3. 1% APTES solution was prepared by adding 500uL APTES stock solution (0.945g/mL) in 49.5mL water
4. Glass slides were plasma treated for 10 minutes
5. Glass slides were fully immersed in the APTES solution and incubated for an hour
6. Glass slides were washed thoroughly 3-4 times to remove excess APTES and dried under nitrogen flow
7. 100 uL of gold nanoparticles 10 nm diameter, OD 1, stabilized suspension in 0.1 mM PBS, reactant free (Sigma-Aldirch, 752584) was added to a small (2cm X 2 cm) marked area on the glass slide.

1. SylgardTM 184 silicone elastomer base was mixed with the curing agent at a mass ratio of 10:1 and mixed thoroughly before pouring in a petri dish
2. It was degased in a desiccator until bubbles disappeared
3. The PDMS was dried in an oven at 60° C for 2 hours
4. PDMS strips of desired size were cut, and plasma treated

1. The glass slides were placed in the chamber, and the pump and power were turned on while holding the door
2. After few seconds, the door was properly ceiled and after the pressure dropped to 200mTorr, the 3-way valve was turned clockwise
3. The pressure was adjusted to 78—820 mTorr
4. RF level was turned high
5. After 10 minutes, the RF level, pump and power were turned off in order
6. The 3-way valve was turned counterclockwise

1. Bare AuNP (680uL) was added to a micro-cuvette characterized using UV-vis Spectrophotometer - Shimadzu UV-2700
2. To investigate the effect of Na in AuNP aggregation, Na solutions (300, 200, 150, 100, 50, 25, 12.5 mM) was added to AuNP and subjected to UV-Vis measurement
3. 175 mM was chosen as the ideal NaCl concentration, and the resulting solution of 680uL AuNP and 175 uL NaCl solution was characterized using UV-Vis spectroscopy
4. Next, a spectroscopy measurement was recorded for a mixed solution of 680 uL AuNP+ 175 uL NaCl (aq)+ 150 2mM aptamer
5. Finally, a spectroscopy measurement was recorded for a mixed solution of 680 uL AuNP+ 175 uL NaCl (aq)+ 150 2mM aptamer+ 3ug/mL amyloid beta (dissolved in DMSO)

1. A UV-Vis spectroscopy measurement was recorded for a blank (empty) glass slide
2. UV-Vis spectroscopy measurement was recorded for a glass slide immersed in 1% APTES
3. UV-Vis spectroscopy measurement was recorded for a glass slide containing APTES+ AuNPs
4. 100uL of various concentrations of thiol unmodified TSO50 aptamer solution (100mM, 80mM, 50mM and 25mM) were added to different AuNP functionalized glass slides and their UV-Vis spectroscopy measurement was recorded to determine the optimum binding concentration of aptamers (determined based on literature observed Uv-Vis spectra observed for aptamer bound AuNP functionalized glass substrate)
5. 50 mM was determined to the optimum concentration
6. 50 uL (1 ng/mL) amyloid beta peptide solution (dissolved in DMSO) was added to the glass slide functionalized with AuNPs and 50mM thiol unmodified TSO50 aptamer and subjected to UV-Vis absorbance measurement

1. [Intermediate Plasmid 1]: Amyloid-β1−42 sequence was amplified by PCR from pET-SUMO-Abeta (Kirstein Lab) with primers cagtcaaccggtcagtcagctagcGATGCAGAATTCCGACATGAC and ataagaatctcgagctaCGCTATGACAACACCGCCCACC.

a. PCR-product and pPD95−77_EGFP (Fire Lab) were digested with AgeI and XhoI.

b. Amyloid-beta(1−42) sequence replaced EGFP sequence.

2. [Intermediate Plasmid 2]: wrmScarlet sequence was amplified by PCR from pSEM87_twk-18_mScarlet (Boulin Lab, 2017) with following primers: cagtcaaccggtcagtcatctagaATGGTCAGCAAGGGAGAGGC and ataagaatgctagcCTTGTAGAGCTCGTCCATTCC. Digestion was performed with AgeI and NheI to insert wrmScarlet upstream of Amyloid-beta(1−42).

3. [Intermediate Plasmid 3]: The rgef-1 promoter was amplified by PCR from pPD95-DBN(wt)-YFP (Kreis et al., 2019) with following primers: cagtcagcatgcCAAGACTAATTTTCGATTAACC and ataagaatatcgatataagaataccggtCGTCGTCGTCGTCGATGCCGTC. Digestion was performed with SphI and AgeI to insert rgef-1p upstream of wrmScarlet-Abeta. (IntermediatePlasmid_03)

4. [Intermediate Plasmid 4] Signalpeptide-Amyloid-β1−42 (SigPep-Abeta) was created by Fusion-PCR using a synthetic 50mer (gttttgctggcactgttctttatctttctggcaccagcaggtaccGACGCG) as first PCR template and CTATAGATCGATGCATAAGGTTTTGCTGGCACTGTTC plus CATGTCGGAATTCTGCATCCGCGTCGGTACCTGCTGG as primers; second PCR template was pET-SUMO-Abeta and CCAGCAGGTACCGACGCGGATGCAGAATTCCGACATG plus TCATCGACCGGTTTACGCTATGACAACACCGCC as primers.

a. The subsequent Fusion-PCR was performed with the products of the first and second PCR as templates and CTATAGATCGATGCATAAGGTTTTGCTGGCACTGTTC plus TCATCGACCGGTTTACGCTATGACAACACCGCC as primers.

b. Digestion was performed with ClaI and AgeI. The product was inserted into IntermediatePlasmid_03, as a result, the promoter sequence lost 400 base pairs. (IntermediatePlasmid_04)

5. [Intermediate Plasmid 5] hsp-3 IRES element was cloned from genomic DNA with the following primers: CCTATGACCGGTTGCTCTCCCTTCACCACTCC and GGATACTCTAGAGCCCAACAAGAATAAGGTCTTCATA. Digestion was performed with AgeI and XbaI before insertion into Intermediate Plasmid 4 between SigPep-Abeta and wrmScarlet-Abeta.

6. The final Signalpeptide-Amyloid-β1−42-IRES sequence was amplified from Intermediate Plasmid 5 with the following primers: CTAACTCCCGGGATGCATAAGGTTTTGCTG and TGACTGCCCGGGTGAGCCCAACAAGAATAAGGTC. Digestion was carried out with XmaI for insertion into IntermediatePlasmid_03 to create the final plasmid that contains all fragments. (pPD95_rgef-1p::SigPep-Aβ1−42-IRES-wrmScarlet-Aβ1−42::unc-54(3′UTR))

7. The neuronal wrmScarlet control was generated by cleaving pPD95.77 with SphI and EcoRI, removing GFP. The promoter of rgef-1 was amplified with the primers cagtcagcatgcCAAGACTAATTTTCGATTAACC plus ataagaatatcgatataagaataccggtCGTCGTCGTCGTCGATGCCGTC and cleaved with SphI and NheI; wrmScarlet was amplified with the primers GATTAGCTAGCATGAAGACCTTATTCTTGTTGG plus GACTAGAATTCCTACTTGTAGAGCTCGTCCATTCC and digested with NheI and EcoRI. The plasmid was ligated with both fragments in one step.

8. The construct for muscular expression of Aβ1−42 with substoichiometric expression of wrmScarlet Aβ1−42 was generated by Gibson Assembly (NEB):

a. The promoter sequence of myo-3 was amplified from pCFJ104 with homologous overlaps to the construct for neuronal expression of Aβ1-42 (pPD95_rgef-1p::SigPep-Aβ1−42-IRES-wrmScarlet-Aβ1−42::unc-54(3′UTR): GCAAAACCTTATGCATCCCGGTCGTCATTTCTAGATGGATCTAGTGGTCGTG and CTTGGAAATGAAATAAGCTTGCATGAGTGATTATAGTCTCTGTTTTCGTTA.

b. The plasmid was amplified with primers bearing matching homologous overlaps, excluding the promoter of rgef-1: CACGACCACTAGATCCATCTAGAAATGACGACCGGGATGCATAAGGTTTTGC and TAACGAAAACAGAGACTATAATCACTCATGCAAGCTTATTTCATTTCCAAG.

9. The muscular wrmScarlet control was cloned by amplifying the promoter of myo-3 with the primers GCTGAACCGGTAGTGATTATAGTCTCTGTTTTCGTTAAT and GATTAGCTAGCCATTTCTAGATGGATCTAGTGGTCG. a. The product was inserted into the neuronal control vector after digestion using AgeI and NheI, replacing the promoter of rgef-1.

10. The construct STOP-Aβ, for expressing Aβ1−42 only was generated by cleaving the neuronal Aβ1−42 expression construct with AgeI to remove SigPep-Aβ1−42. a. The two oligonucleotides CCGGATGGGTGCATAAGCATAAC and GGCCGTTATGCTTATGCACCCAT were phosphorylated using T4-polynucleotide kinase and annealed by a gradient from 95 °C (5 min) to 25 °C (over 15 min). b. The annealed construct was ligated into the AgeI cleavage site of the vector.

11. To achieve cell-specific knockdown of Aβ1−42, a short hairpin construct of the peptide was generated and expressed under the control of cell-specific promoter regions (Esposito et al., 2007).

12. The short hairpin construct against Aβ1−42 in URY neurons was generated by amplifying Aβ1-42 with the primers GCATTGCATGCGCTATGACAACACCGC and GCATTGCATGCGATGCAGAATTCCGACATGAC.

a. Both, amplificate and the plasmid pPD95.77 were digested with SphI to insert the PCR product and correct orientation of the insert was confirmed by sequencing.

b. Inverse Aβ1−42 was cloned with the primers GCATTGGATCCGCTATGACAACACCGCC and GCATTGCTAGCGATGCAGAATTCCGACATG; the splice leader 2 sequence from gdp-2 was amplified with the primers GCATTGCTAGCGCTGTCTCATCCTACTTTCAC and GCATTACCGGTGATGCGTTGAAGCAGTTTC.

c. Both were cleaved with BamHI, NheI and AgeI and inserted into the prepared vector pPD95.77 + Aβ1−42, which had been cleaved with BamHI and AgeI to generate pPD95.77 + Aβ1−42for/rev::sl2. Aβ1−42for/rev::sl2 was amplified with the primers GGATTGGTACCGCATGCGATGCAGAATTCCGAC and GCATTGGTACCGGTGATGCGTTGAAGCAG cleaved with KpnI for insertion into the vector pJB253 bearing tol-1p::GFP.

13. To express the short hairpin construct against Aβ1−42 in IL2 neurons of C. elegans, the promoter of klp-6 was amplified from pEY54 using the primers cagtcagcatgcGTTGGAAAGTTTGGTAAGTTGC and ataagaatggtaccatGGTATTCTGAAAAGTTCAAC.

a. Digestion was carried out with SphI and KpnI to insert the amplified fragment into pPD95.77.

b. Subsequently, the sequence for Aβ1−42for/rev::sl2 was amplified with the primers ataagaataccggtGATGCAGAATTCCGACATGAC and ataagaatctcgagGATGCGTTGAAGCAGTTTCC and inserted behind the promoter by restriction digestion with AgeI and XhoI, respectively, partially replacing the GFP sequence in pPD95.77.

14. Plasmid verified by sequencing

1. Henning-Knechtel, A., Kumar, S., Wallin, C., Król, S., Wärmländer, S. K. T. S., Jarvet, J., . . . Magzoub, M. (2020).Designed Cell-Penetrating Peptide Inhibitors of Amyloid-beta Aggregation and Cytotoxicity. Cell Reports Physical Science, 1(2), 100014. doi:https://doi.org/10.1016/j.xcrp.2020.100014
2. Stine, W. B., Jungbauer, L., Yu, C., & LaDu, M. J. (2011). Preparing synthetic Aβ in different aggregation states. Methods Mol Biol, 670, 13-32. doi:10.1007/978-1-60761-744-0_2
3. Gallrein, C., Iburg, M., Michelberger, T., Koçak, A., Puchkov, D., Liu, F., Ayala Mariscal, S. M., Nayak, T., Kaminski Schierle, G. S., & Kirstein, J. (2021). Novel amyloid-beta pathology C. elegans model reveals distinct neurons as seeds of pathogenicity. Progress in Neurobiology, 198, 101907. https://doi.org/https://doi.org/10.1016/j.pneurobio.2020.101907