Protocols



DNA extraction protocol

Introduction

The objective of this protocol is to extract the genomic DNA from Arabidopsis thaliana plants.

Materials

  • 1 piece of a young leaf of A. thaliana
  • 50 µL Extraction solution:
    • 100 mM Tris-HCl pH=8
    • 250 mM KCl
    • 10 mM EDTA
  • 50 µL Dilution Solution
  • 3% BSA powder

Process:

  1. Cut a piece of a young leaf with a pair of tweezers, place it in a PCR tube and crush it with a pipette tip.
  2. Add 50 µL of Extraction solution. Close the tube, vortex, and spin briefly to make sure the tissue is covered by the solution.
  3. Incubate at 95ºC for 10 minutes.
  4. Add 50 µL of Dilution solution and mix by pipetting up and down.
  5. Store the diluted leaf extract at 4ºC.
  6. Use 1 µL of the extract as a template for your PCR.


PCR of the promoters

The main task of this procedure is to amplify the selected promoters. We are going to need the following equipment:

  • High Fidelity DNA Polymerase
  • Genomic DNA
  • Thermocycler
  • Primers:
Primer Sequence
ACO3 attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTATCTTGTCGGAAACATGTTGGAGAAC
ACO3 attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTAGATGATGAAATCACGCTTCCAGATG
ADH1 attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTACGTCCTCTTGGGCCTATGATTC
ADH1 attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTATATCAACAGTGAAGAACTTGCTTTTG
ALDH2 attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTAAAATCTCGCAATCGTGTCAAAAACC
ALDH2 attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTAGGATGAAACAAGTTTCAAGCTTTAAG
ATPS attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTACGAAGAAGAACGGAGAAGCGATG
ATPS attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTAGAGTGGGTGTGTGTTTGAGAGAG
CI76 attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGATGCAGTGGACAAAGCGG
CI76 attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTAGGCGTTGTGGATCTGTATCGTC
CIII14 attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTACTTACCTTTGGGTCTTGCTCGAG
CIII14 attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTATATCTTCTTCGGAGTAACGTTGAAG
CSY4 attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTATCCGAACCGAATATAGCCGTAACG
CSY4 attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTATCTCCAAAACTCAAAACCTGTGAC
G3PDG attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACCGGAAGCTCTTTGAGGAAAAGG
G3PDG attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTATGATTCGGAAGTGGGAGAAACAAAAG
HB1 attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTATTAGTGTAGTATTGGACATTGAAAG
HB1 attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTAAATATTTCACAACCTCTAAATGATTT

Protocol:

  • 10 μL of DNA Polymerase High Fidelity
  • 1 μL primer attB1
  • 1 μL primer attB2
  • 1 μL extracted genomic DNA
  • 7 μL H2O

The total volume of each Eppendorf is 20 μL.

Process:

In order to avoid pipetting errors, we prepared a pre-mix with the DNA polymerase, genomic DNA, and water. Then, we dispensed 18 μL in each PCR tube and added the primers. We placed the tubes in the thermocycler with the following program:



Seeds sterilization

Introduction

In our project, we are going to work with Nicotiana benthamiana plants. We start the germination in vitro, so we are going to sterilize the seeds.

Materials:

  • 1 ml of ethanol
  • 1 ml of bleach diluted in ¼
  • Autoclaved water
  • Seeds of Nicotiana benthamiana
  • Murashige and Skoog (MS) medium plates

Process:

  1. We introduce the seeds in an Eppendorf and add 1 mL of ethanol. Shake with our hands for 2 minutes.
  2. Afterward, we withdraw the ethanol and pour 1 mL of diluted bleach. The tube is kept in a shaker for 15 minutes.
  3. Remove the bleach and wash it 4 times with sterile water shaking manually.
  4. Sow the seeds with the pipette in the culture medium.
  5. Transplant the seed into autoclaved soil in a lapse of time from 7 to 10 days.


Preparation of LB medium + Zeocin

Introduction

We are going to prepare ½ L of LB plates supplemented with Zeocin antibiotic. In this medium, we are planning to grow our bacteria which will have our pDONR plasmid. This plasmid has a Zeocin resistance gene, so only our modified bacteria will be able to grow.

Materials:

  • 500 mL of Mili Q water
  • LB (powder) broth. 20 gr/L
    • We are using 10 gr
  • Bacteriological agar 15 gr/L
    • We are using 7.5 gr
  • Zeocin solution (100 mg/mL)
  • Sterile Petri dishes

Process:

  1. Dissolve the LB broth in 500 mL of MilliQ water.
  2. Add the bacteriological agar.
  3. Autoclave the medium and let it cool down.
  4. Pour the medium into sterile Petri dishes, and let them solidify in a sterile cabinet.
  5. Close and store the plates at 4ºC.


Promoter electrophoresis

Introduction

We will verify the PCR reaction of the promoters.

Materials:

  1. PCR product
  2. Water
  3. Loading buffer (glycerol + dye)
  4. Agarose
  5. 1x TAE buffer
  6. Molecular weight ladder

Procedure:

  • Pour the agarose with 15 µL of Midori Green into a gel tray with the well comb in place. We have to wait until it solidifies. Then we remove the comb and move the gel to the electrophoresis cuvette. We cover the gel with TAE 1%.
  • To prepare the samples we add 2 µL of PCR, 16 µL of water 2 µL of loading buffer. We load the samples into the wells of the gel.
  • We load 7 µL of the molecular weight ladder into the first lane of the gel.
  • Run the gel at 80-150 V until the dye line is approximately 75-80% of the way down the gel.
  • Afterward, we take the gel to a device that has UV light and takes a photo to analyze the results.


    • BP reaction

    Introduction

    In this step, the promoters are cloned in the plasmid (pDNOR/Zeo) by the recombination reaction of the attB1→ attP1, and attB2→ attP2 sites.

    Materials:

    • 1 µL pDNOR/Zeo (150 ng/µL)
    • 150 ng of PCR promoter
    • 1 µL BP clonase
    • 6 µL Buffer TE

    Process:

    1. Mix 1 µL of BP clonase with the 6 µL of Buffer (TE) and 1 µL pDONR (Zeo)
    2. Add the proper volume of PCR promoter
    3. Hold at 25ºC for 1 hour
    4. Store at 4ºC


    BP Electroporation

    Introduction

    The finality of this procedure is to introduce our plasmid inside the bacteria, in this case, Escherichia coli

    Materials:

    • Electrocompetent cells E. coli Top 10
    • Plasmids pDONR-prom
    • 1 mL of liquid LB medium
    • Electroporation cuvettes (1 mm)
    • Bio-Rad GenePulser electroporator
    Process:
    1. Place electroporation cuvettes and microcentrifuge tubes on ice.
    2. Thaw an aliquote of electrocompetent cells on ice and add 1 μl of the BP reaction. Mix cells by flicking gently.
    3. Transfer the cell/DNA mix into a chilled cuvette. Electroporate using the following conditions:
      • Capacitance (F): 25
      • Resistance (Ω): 200
      • Voltage (KV): 1.25
      • Time (ms): 4.68
    4. Immediately add 1 mL of LB medium to the cuvette and transfer all liquid to an Eppendorf tube.
    5. Shake vigorously (250 rpm) at 37°C for 1 hour.
    6. Spread the cells onto a Zeocin plate.
    7. Incubate plates overnight at 37°C.


    Colonies PCR

    Introduction

    This protocol will let us identify E. coli colonies that contain the plasmid of interest.

    Materials:

    • Takara routine ADN polymerase
    • attB1 promoter primer
    • attB2 promoter primer
    • Plate with colonies
    • Water
    • Thermocycler

    Procedure:

    In a sterile environment, we select 20 colonies for each promoter. We mark and number them on the petri dish. After that, in an Eppendorf tube, we add 10 µL of water and 2 colonies. That way, we will have 20 colonies in 10 Eppendorf. Then, we will let them boil at 100ºC for 3-5 minutes and centrifuge them for 3 minutes at 12 000 rpm.

    The next step is to mix the polymerase, the primers of each promoter, and 3 µL of the colonies in PCR tubes. Finally, we transfer the PCR tubes to the thermocycler. When the PCR finishes, we check the result by electrophoresis (explained above how to do one).



    Plasmid extraction protocol

    Introduction

    After checking which colonies have the plasmid, we transfer them to LB liquid medium to grow and then we extract the plasmids from the bacteria with the OMEGA BIO-TEK PLASMID DNA MINI KIT I.

    Materials:

    • 250 µL of Solution I
    • 250 μL of Solution II
    • 350 μL of Solution III
    • 500 μL HBC Buffer
    • 700 μL DNA Wash Buffer
    • 75 μL of water
    • Eppendorf of 1.5 mL

    Process:

    1. Grow 5 mL culture overnight in a 50 mL culture tube
    2. Centrifuge at 10,000 × g for a minute at room temperature. Decant and discard the culture media.
    3. Add 250 μL Solution I mixed with RNase A. Vortex to mix thoroughly. Transfer suspension into a new 1.5 ml microcentrifuge tube
    4. Add 250 μl Solution II. Invert and gently rotate the tube several times to obtain a clear lysate.
    5. Add 350 Solution III and immediately invert several times until a flocculent white precipitate forms. Centrifuge at maximum speed for 10 minutes. A compact white pellet will form. Promptly proceed to the next step.
    6. Insert a HiBind DNA Mini Column into a 1.5 mL collection tube.
    7. Transfer the cleared supernatant from Step 5 by CAREFULLY aspirating it into the HiBind DNA Mini Column. Centrifuge at maximum speed for a minute. Discard the filtrate and reuse the collection tube.
    8. Add 500 μL HBC Buffer diluted with 100% isopropanol (see the bottle for instructions). Centrifuge at maximum speed for 1 minute. Discard the filtrate and reuse the collection tube.
    9. Add 700 μL DNA Wash Buffer. Centrifuge at maximum speed for 30 seconds. Discard the filtrate and reuse the collection tube.
    10. Centrifuge the empty HiBind DNA Mini Column at maximum speed for 2 minutes to dry the column. This step is critical for the removal of trace ethanol that may interfere with downstream applications.
    11. Transfer the HiBind DNA Mini Column into a nuclease-free 1.5 ml microcentrifuge tube.
    12. Add 75 μL of water. Let sit at room temperature for a minute. Centrifuge at maximum speed for 1 minute.


    Digestion and electrophoresis

    Introduction

    We cut the plasmids with specific restriction enzymes and then we analyze the contents by gel electrophoresis to confirm that our plasmids are correctly formed.

    Materials:

    • 2 µL Buffer
    • 0.5 µL of each specific enzyme
    • 1 µg of plasmid
    • Water up to 20 µL

    Procedure:

    1. Mix everything in 1.5 ml Eppendorf tubes and incubate the reaction at digestion temperature (usually 37 °C) for 1 hour.
    2. After it’s done, we run the samples in electrophoresis to check the size of the fragments.


    LR reaction

    Introduction

    In this step, the pDONR plasmid transfer the promoter to the final plasmid (pMDC107) by the recombination of the attL1→attR1 and attL2→attR2 sites.

    Materials:

    • 150 ng of pMDC107
    • 150 ng of pDONR-prom
    • 1 µL LR clonase
    • 6 µL TE Buffer

    Process:

    1. Mix the LR clonase, the Buffer and the pMDC107
    2. Add the proper pDONR-prom to the mix
    3. Hold at 25ºC for 1 hour
    4. Store at 4ºC


    LR electroporation

    Introduction

    The finality of this procedure is to introduce our final plasmid pMDC107-prom inside the bacteria, in this case, Escherichia coli.

    Materials:

    • Electrocompetent cells: E. coli Top 10
    • Plasmids pMDC107-prom Kan
    • 1 mL of LB liquid medium
    • Electroporation cuvettes (1 mm)
    • Bio-Rad GenePulser electroporator

    Process:

    1. Place electroporation cuvettes and microcentrifuge tubes on ice.
    2. Thaw an aliquote of electrocompetent cells on ice and add 1 μl of the LR reaction. Mix cells by flicking gently.
    3. Transfer the cell/DNA mix into a chilled cuvette. Electroporate using the following conditions:
      • Capacitance (F): 25
      • Resistance (Ω): 200
      • Voltage (KV): 1.25
      • Time (ms): 4.68
    4. Immediately add 1 mL of LB medium to the cuvette and transfer all liquid to an Eppendorf tube.
    5. Shake vigorously (250 rpm) at 37°C for 1 hour.
    6. Spread the cells onto a Kanamycin plate.
    7. Incubate plates overnight at 37°C.

    Colonies PCR, Plasmid extraction protocol, and Digestion and electrophoresis were performed as have been described before.



    Agrobacterium tumefaciens electroporation

    Introduction

    We need to transform Agrobacterium tumefaciens with the plasmids pMDC107-prom to be able to infiltrate our plants.

    Materials:

    • Electrocompetent cells: A. tumefaciens
    • Plasmids pMDC107-prom
    • 1 mL of LB liquid medium
    • Electroporation cuvettes (1 mm)
    • Bio-Rad GenePulser electroporator

    Process:

    1. Place electroporation cuvettes and microcentrifuge tubes on ice.
    2. Thaw an aliquote of electrocompetent cells on ice and add 1 μl of plasmid pMDC107-prom. Mix cells by flicking gently.
    3. Transfer the cell/DNA mix into a chilled cuvette. Electroporate using the following conditions:
      • Capacitance (F): 25
      • Resistance (Ω): 400
      • Voltage (KV): 1.25
      • Time (ms): 8.50
    4. Immediately add 1 mL of LB medium to the cuvette and transfer all liquid to an Eppendorf tube.
    5. Shake vigorously (250 rpm) at 28°C for 1 hour.
    6. Spread the cells onto a kanamycin plate.
    7. Incubate plates overnight at 28°C.

    Colonies PCR and electrophoresis were performed as have been described before.

    Agrobacterium preparation for Nicotiana benthamiana infiltration/p>

    Procedure:

    1. We grow one single colony of Agrobacterium in 50 ml LB with appropriate antibiotics (30 μg/ml rifampicin and 50 μg/ml kanamycin). Start the Agrobacterium culture of pMDC107-prom and the Agrobacterium containing plasmid p19 (a suppressor of gene silencing that must be coinfiltrated for proper gene expression).
    2. Grow for 2 days at 28°C.
    3. Precipitate the bacteria (5,000 x g, 15 min), resuspend the pellet in resuspension buffer (10 mM MES/KOH pH=5.6, 10 mM MgCl2, 150 μM acetosyringone)
    4. Measure the A600. We need to prepare the Agrobacterium with our construction to A600 =1 and the Agrobacterium with p19 to A600 = 2.
    5. Mix equal volumes (10 ml and 10 ml) of Agrobacterium with our construction and with p19.
    6. Incubate between 2-5 h at room temperature.


    Infiltration of Nicotiana benthamiana for transient expression

    Conditions:

    We use Nicotiana benthamiana growth in long days (16 h light/8 h dark) for 3-4 weeks. Leaves must be 3-5- cm long (do not use older leaves).

    Materials:

    1. 20 ml of Agrobacterium tumefaciens mix prepare as was described before.
    2. Nicotiana benthamiana plants.
    3. 1 mL syringe without a needle.

    Procedure:

    Infiltrate the mixture using a 1-mL syringe without a needle into the abaxial (bottom) side of N. benthamiana leaves. Flip the leaf to see the bottom side and apply a little bit of pressure and introduce the bacteria.

    CAUTION: Beware not to break the leaf while applying pressure.

    Introduce the solution slowly and be aware that you are avoiding any leaks. If the spot doesn’t admit more liquid, change the location. Repeat this process in at least two different leaves of the same plant.

    Note

    • Cover your eyes with safety goggles (A. tumefaciens is not pathological for humans but like this, you can avoid bad experiences).


    CO2 Exposure

    Introduction

    Two days after the infiltration we have to expose the modified plants to high CO2 levels in a phytotron.

    In the beginning, we tried different exposition times for high CO2 concentrations (6 and 24 hours). We observed that there were relevant changes only in those who were exposed for 24 hours, so we did all experiments at 24 h of exposition to high CO2 .

    Procedure:

    1. Prepare at least two plants of each promoter and infiltrate them with the previous protocol.
    2. Place a plant in a chamber with ambient CO2 concentration (control) and another in a chamber with high CO2 concentration (1,000 ppm).


    Confocal microscope observation

    Introduction

    In the confocal microscope we see the fluorescence emitted by GFP.

    1. Cut a small piece from a leaf and place it over a slide with drops of water.
    2. Place a coverslip.
    3. Important: we have to observe the abaxial side of the leaf to see the GFP expression successfully.