Parts Collection
Introduction
We created various constructs to display chitinase on the surface of B. subtilis spores, to assemble a self-digesting plasmid, and to engineer the germinant receptors. Here is a complete list of parts we used and created to clone our constructs in E.coli and to transform B. subtilis. We created 18composite parts in total for different aspects of our project.
Primers List
We made an extensive use throughout our project of custom-designed primers, from colony PCRs, amplification, assembly and more.
List of Parts
Basic Parts
| Part name | Part type | Short Description (Ex. Short Description is luxC) | Usage (Explain what you used the part for in your project, and what other uses it might serve) | Biology (biological origin and purpose of your part) | Design considerations you've taken and the reasons for them | Sequence |
|---|---|---|---|---|---|---|
| BBa_K4212000 | CDS | CotG_ChiS | This part codes for a fusion protein consisting of the B. subtilis native CotG anchor protein and a B. pumilus chitinase enzyme. The CotG protein has a midspore localization and high abundance in B. subtilis spores, enabling spore display. In this case with the chitinase fusion, spores will display chitinases on the surface capable of breaking down chitin into its monomer components, such as N-acetylglucosamine. In the context of our project, the chitinase activity enables us to equip spores with the ability to breakdown the chitin-rich outer coat of fungal pathogens, not only inhibiting their activity but generating chitin monomers that can function as a biomarker, as well as an inducer of plant systemic immune response. | The CotG CDS comes from the genome of B. subtilis, and was produced through genome amplification with appropriately designed primers. The chitinase protein sequence comes from the B. pumilus, however this was codon-optimised for B. subtilis and synthesized as a gBlock (IDT). The individual CDSs were also either ordered or amplified with Type IIS restriction sites on either end, to enable scarless fusion as a single CDS in a level 0 plasmid within a Golden Gate system. | This is a direct tandem C'terminal fusion. | TTGGGCCACTATTCCCATTCTGACATCGAAGAAGCGGTGAAATCCGCAAAAAAAGAAGGTTTAAAGGATTATTTATACCAAGAGCCTCATGGAAAAAAACGCAGTCATAAAAAGTCGCACCGCACTCACAAAAA |
| BBa_K4212001 | CDS | CotG_3Gx3_ChiS | This part codes for a fusion protein consisting of the B. subtilis native CotG anchor protein and a B. pumilus chitinase enzyme. The CotG protein has a midspore localization and high abundance in B. subtilis spores, enabling spore display. In this case with the chitinase fusion, spores will display chitinases on the surface capable of breaking down chitin into its monomer components, such as N-acetylglucosamine. In the context of our project, the chitinase activity enables us to equip spores with the ability to breakdown the chitin-rich outer coat of fungal pathogens, not only inhibiting their activity but generating chitin monomers that can function as a biomarker, as well as an inducer of plant systemic immune response. This fusion includes a flexible linker, to reduce steric hindrance between the two protein domains and enable greater chitinase activity. The same was selected for testing following dry lab modelling. | The CotG CDS comes from the genome of B. subtilis, and was produced through genome amplification with appropriately designed primers. The reverse primer included the sequence for the synthetic flexible linker. The chitinase protein sequence comes from the B. pumilus, however this was codon-optimised for B. subtilis and synthesized as a gBlock (IDT). The individual CDSs were also either ordered or amplified with Type IIS restriction sites on either end, to enable scarless fusion as a single CDS in a level 0 plasmid within a Golden Gate system. | 3Gx3 - flexible linker | TTGGGCCACTATTCCCATTCTGACATCGAAGAAGCGGTGAAATCCGCAAAAAAAGAAGGTTTAAAGGATTATTTATACCAAGAGCCTCATGGAAAAAAACGCAGTCATAAAAAGTCGCACCGCACTCACAAAAA |
| BBa_K4212002 | CDS | CotG_4Gx3_ChiS | This part codes for a fusion protein consisting of the B. subtilis native CotG anchor protein and a B. pumilus chitinase enzyme. The CotG protein has a midspore localization and high abundance in B. subtilis spores, enabling spore display. In this case with the chitinase fusion, spores will display chitinases on the surface capable of breaking down chitin into its monomer components, such as N-acetylglucosamine. In the context of our project, the chitinase activity enables us to equip spores with the ability to breakdown the chitin-rich outer coat of fungal pathogens, not only inhibiting their activity but generating chitin monomers that can function as a biomarker, as well as an inducer of plant systemic immune response. This fusion includes a flexible linker, to reduce steric hindrance between the two protein domains and enable greater chitinase activity. The same was selected for testing following dry lab modelling. | The CotG CDS comes from the genome of B. subtilis, and was produced through genome amplification with appropriately designed primers. The reverse primer included the sequence for the synthetic flexible linker. The chitinase protein sequence comes from the B. pumilus, however this was codon-optimised for B. subtilis and synthesized as a gBlock (IDT). The individual CDSs were also either ordered or amplified with Type IIS restriction sites on either end, to enable scarless fusion as a single CDS in a level 0 plasmid within a Golden Gate system. | 4Gx3 - flexible linker | TTGGGCCACTATTCCCATTCTGACATCGAAGAAGCGGTGAAATCCGCAAAAAAAGAAGGTTTAAAGGATTATTTATACCAAGAGCCTCATGGAAAAAAACGCAGTCATAAAAAGTCGCACCGCACTCACAAAAA |
| BBa_K4212003 | CDS | CotG_AHx3_ChiS | This part codes for a fusion protein consisting of the B. subtilis native CotG anchor protein and a B. pumilus chitinase enzyme. The CotG protein has a midspore localization and high abundance in B. subtilis spores, enabling spore display. In this case with the chitinase fusion, spores will display chitinases on the surface capable of breaking down chitin into its monomer components, such as N-acetylglucosamine. In the context of our project, the chitinase activity enables us to equip spores with the ability to breakdown the chitin-rich outer coat of fungal pathogens, not only inhibiting their activity but generating chitin monomers that can function as a biomarker, as well as an inducer of plant systemic immune response. This fusion includes a rigid linker, to reduce steric hindrance between the two protein domains and enable greater chitinase activity. The same was selected for testing following dry lab modelling. | The CotG CDS comes from the genome of B. subtilis, and was produced through genome amplification with appropriately designed primers. The reverse primer included the sequence for the synthetic rigid linker. The chitinase protein sequence comes from the B. pumilus, however this was codon-optimised for B. subtilis and synthesized as a gBlock (IDT). The individual CDSs were also either ordered or amplified with Type IIS restriction sites on either end, to enable scarless fusion as a single CDS in a level 0 plasmid within a Golden Gate system. | AHx3 - rigid linker | TTGGGCCACTATTCCCATTCTGACATCGAAGAAGCGGTGAAATCCGCAAAAAAAGAAGGTTTAAAGGATTATTTATACCAAGAGCCTCATGGAAAAAAACGCAGTCATAAAAAGTCGCACCGCACTCACAAAAA |
| BBa_K4212004 | CDS | CotZ_ChiS | This part codes for a fusion protein consisting of the B. subtilis native CotZ anchor protein and a B. pumilus chitinase enzyme. The CotZ protein localizes in the outer coat of B. subtilis spores, enabling spore display and greater accessibility to . In this case with the chitinase fusion, spores will display chitinases on the surface capable of breaking down chitin into its monomer components, such as N-acetylglucosamine. In the context of our project, the chitinase activity enables us to equip spores with the ability to breakdown the chitin-rich outer coat of fungal pathogens, not only inhibiting their activity but generating chitin monomers that can function as a biomarker, as well as an inducer of plant systemic immune response. This fusion includes a rigid linker, to reduce steric hindrance between the two protein domains and enable greater chitinase activity. The same was selected for testing following dry lab modelling. | The CotZ CDS comes from the genome of B. subtilis, and was produced through gene synthesis. The chitinase protein sequence comes from the B. pumilus, however this was codon-optimised for B. subtilis and synthesized as a gBlock (IDT). The individual CDSs were also ordered with Type IIS restriction sites on either end, to enable scarless fusion as a single CDS in a level 0 plasmid within a Golden Gate system. | Selection of CotZ enables display on spore crust rather than a midspore localisation, however abundance is lower than other anchor proteins. This influences the activity of observed of both the chitinase enzyme and the level of chitin degradation obtained through the engineered spore. Chitinase sequence is codon optimised for B. subtilis. | AGCCAGAAAACATCAAGCTGCGTGCGTGAAGCTGTAGAAAATATTGAAGATCTGCAAAACGCTGTTGAAGAAGATTGCCCGACCGGCTGCCACTCTAAGCTTTTATCTGTAAGCCATTCGTTAGGCGACACAGTGC |
| BBa_K4212005 | CDS | gRNA_SDP | Designed for CRISPR system introducing double stranded cut in origin of replication of BBa_K4212031 part (Golden Gate level 2 B. subtilis expression vector). Useful for production of self-digesting plasmid system functional in B. subtilis. | Synthetic construct | Composed of a gRNA scaffold and target region aimed at origin of replication of BBa_K4212031 part (Golden Gate level 2 B. subtilis expression vector). | ggtaactatcgtcttgagtccaaccGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTCGGTA |
| BBa_K4212006 | CDS | D15 | Exonuclease coding sequence | Protein sequence from T5 bacteriophage genome, coding sequence optimised for B. subtilis. | Codon optimized for B. subtilis | ATGTCAAAAAGCTGGGGCAAATTTATCGAAGAGGAAGAGGCAGAAATGGCATCTAGAAGAAATCTGATGATTGTCGATGGCACAAATCTGGGCTTTCGCTTTAAACATAACAACAGCAAAAAGCCGTTTGCGTCA |
| BBa_K4212007 | CDS | Cas9_B_subtilis | A dual RNA-guided DNA endonuclease enzyme | Native to S. pyogenes | Codon optimized for B. subtilis | ATGGATAAGAAATACTCAATAGGCTTAGATATCGGCACAAATAGCGTCGGATGGGCGGTGATCACTGATGAATATAAGGTTCCGTCTAAAAAGTTCAAGGTTCTGGGAAATACAGACCGCCACAGTATCAAAAA |
| BBa_K4212008 | CDS | GerA_operon | Operon encoding the GerA germinant receptor of B. subtilis. Can be used to introduce the receptor in knockout strains without germinant receptors, as well as for directed evolution of said receptor using saturation mutagenesis or error-prone PCR. | Native sequence from B. subtilis genome. | Codon optimised to remove recognition sites for BbsI, BsaI and BsmbI to enable assembly in Golden Gate system. | atgTTGGAACAAACAGAGTTTAAGGAATATATACACGATAATTTAGCATTGGTGCTGCCAAAATTAAAAGAAAACGATGATCTGGTGAAAAACAAAAAAATGCTTGCGAACGGACTGGTTTTTTACTATCTCTATTT |
| BBa_K4212009 | CDS | GerAK_chimera | Synthetic operon designed with GerAA, GerKB and GerAC coding sequences from the B. subtilis genome. Designed to be transformed in a B. subtilis knockout strain so as to produce a germinant receptor that contains a binding site for glucose, and when activated triggers an orthogonal signalling cascade resulting in germination. | Synthetic construct using native coding sequences from GerA sub-units and GerK sub-units of B. subtilis. | Given that the GerAA, GerAC and GerKB came from different operons in the B. subtilis genome, the same had to be refactored. Careful consideration was made in regards to the native upstream region used in front of the GerKB coding sequence, which contains the RBS. | TATGTTGGAACAAACAGAGTTTAAGGAATATATACACGATAATTTAGCATTGGTGCTGCCAAAATTAAAAGAAAACGATGATCTGGTGAAAAACAAAAAAATGCTTGCGAACGGACTGGTTTTTTACTATCTCTATT |
| BBa_K4212010 | CDS | GerAK_modified_chimera | Synthetic operon designed with GerAA, GerKB and GerAC coding sequences from the B. subtilis genome. Designed to be transformed in a B. subtilis knockout strain so as to produce a germinant receptor that contains a binding site for glucose, and when activated triggers an orthogonal signalling cascade resulting in germination. It is an improved version of the GerAK chimera. | Synthetic construct using native coding sequences from GerA sub-units and GerK sub-units of B. subtilis. | Combined GerAA, GerAC and GerKB into a single construct | ATGGAAAAAGCCAGAATAAGCATAAGGCAGTTGTTTGTCATGATTATCATTTTTGAACTGGGCAGCTCCTTATTGATTACACCGGGATCAATGGCGGGCAGGGATGCTTGGATAGCAGTTTTATTAGGCTGTGCGA |
| BBa_K4212011 | CDS | GFPmut3b | Green fluorescent protein functional in B. subtilis. Used for screening the colonies to test if the bacteria successfully take in the cloned construct. | Synthetic construct | Easy to differentiate bacteria colonies. Can be used to see the presence of particular constructs. | GCATGAAGACTacgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccat |
| BBa_K4212012 | Promoter | CotG_native | Native promoter of CotG, sequence of 200 bases upstream of the CotG CDS. Utilised in transcriptional units with CotG fusion proteins. | Native to B. subtilis 168 genome. | Native to B. subtilis 168 genome. Can be used to initiate the transcription of CotG. | ACGCAAGTCTTTTGGATGAACAAACAGCTGATAAAGCGGTAAATTGGATTGATTCTTCATCCATAATCCTCCTTACAAATTTTAGGCTTTTATTTTTATAAGATCTCAGCGGAACACTTATACACTTTTTAAAACCGCG |
| BBa_K4212013 | Promoter | Hyperspank | Inducible promoter with IPTG | Synthetic construct incorporating the restriction enzyme BsaI | ctactctttaataaaataatttttccgttcccaattccacattgcaataatagaaaatccatcttcatcggctttttcgtcatcatctgtatgaatcaaatcgccttcttctgtgtcatcaaggtttaattttttatgtatttcttttaacaaaccaccataggagattaaccttttacggtgtaaaccttcct | |
| BBa_K4212014 | Promoter | PlepA | Strong constitutive promoter in B. subtilis | Native to B. subtilis 168 genome. | Strong constitutive promoters can deliver a high-level expression of selected genes. | agtcaatgtatgaatggatacgggatatgaatcaataagtacgtgaaagagaaaagcaacccagatatgatagggaacttttctctttcttgttttacattgaatctttacaatcctattgatataatctaagctagtgtattttgcgtttaatagt |
| BBa_K4212015 | Promoter | PsspB | Potential promoter regulating sspB expression in B. subtilis. PsspB only express strongly after the initiation of sporulation. | Native to B. subtilis 168 genome. | The promoter for the B.subtilis sspB gene (PsspB) can aid the transcription of sspB gene, which promotes the sporalation of the B.subtilis cells. | tcaagatttaccacacaattctccgcatgattttccggccattttaacataatacgtagtaacaagccggcaaagcattgggtta |
| BBa_K4212016 | RBS | RBS1 | Very strong RBS in B. subtilis | Native to B. subtilis 168 genome. | A very strong promoter can promote efficient and accurate translation of mRNA in prokaryotes. | AGGAGGCTAGCCT |
| BBa_K4212017 | RBS | RBS2 | Strong RBS in B. subtilis | Native to B. subtilis 168 genome. | A strong promoter can promote efficient and accurate translation of mRNA in prokaryotes. | GAGGAGCTAGCCT |
| BBa_K4212018 | RBS | RBS3 | Medium RBS in B. subtilis | Native to B. subtilis 168 genome. | Trying multiple RBS allows us to select the best one for our construct design. | AGGAGA |
| BBa_K4212019 | RBS | Optimal_RBS | Very strong RBS in B. subtilis +25 folds | Native to B. subtilis 168 genome. | Trying multiple RBS allows us to select the best one for our construct design. | taaggaggaaaaaaaa |
| BBa_K4212020 | Spacer | 0A-Spacer | Neutral spacer sequence | Synthetic construct | Synthetic and neutral spacer sequence having no effect on transcription units. Neutral spacer sequence that separates the coding sequences of Cas9 D15 , and constructs pCas9 level 1 plasmid | AGAGggcggcggcACAT |
| BBa_K4212021 | Spacer | 0D-Spacer | Neutral spacer sequence | Synthetic construct | Synthetic and neutral spacer sequence having no effect on transcription units. Neutral spacer sequence that separates the coding sequences of Cas9 and D15 , and constructs pD15 level 1 plasmid | GACAggcggcggcACGG |
| BBa_K4212022 | Terminator | tL3S2P21 | Strongest synthetic transcriptional terminator in E. coli. Recombination resistant | Synthetic construct | The use of strong terminators will result in an enhanced level of mRNA and protein production | ctcggtaccaaattccagaaaagaggcctcccgaaaggggggccttttttcgttttggtcc |
| BBa_K4212023 | Terminator | Spy Terminator | Strongest neutral transcriptional terminator in E. coli. It displays recombination resistance. | Native to E. coli. | The use of strong terminators will result in an enhanced level of mRNA and protein production | ttcagccaaaaaacttaagaccgccggtcttgtccactaccttgcagtaatgcggtggacaggatcggcggttttcttttctcttctcaa |
| BBa_K4212024 | Terminator | B0015 | Strong transcriptional double terminator in E. coli | Synthetic construct | Adapted from EcoFlex Multifunctional MoClo kit | ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata |
| BBa_K4212064 | Vector | STK-0-sfGFP | Entry-level plasmid containing a sfGFP dropout cassette | Synthetic construct | sfGFP dropout cassette inserted within the MCS of backbone, flanking with BsaI and BsmBI sites. Dropout cassette is replaced by target sequences, which enables to verify the insertion of target sequences if transformants do not express sfGFP. | gaaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattg |
| BBa_K4212027 | Vector | STK-1A-sfGFP | Destination plasmid containing a sfGFP dropout | Synthetic construct | sfGFP dropout cassette inserted within the MCS of backbone, flanking with BsaI and BsmBI sites. Dropout cassette is replaced by target sequences, which enables to verify the insertion of target sequences if transformants do not express sfGFP. | ccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagagccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaat |
| BBa_K4212028 | Vector | STK-1B-sfGFP | Destination plasmid containing a sfGFP dropout | Synthetic construct | sfGFP dropout cassette inserted within the MCS of backbone, flanking with BsaI and BsmBI sites. Dropout cassette is replaced by target sequences, which enables to verify the insertion of target sequences if transformants do not express sfGFP. | gttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagagccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaacttta |
| BBa_K4212065 | Vector | STK-1C-sfGFP | Destination plasmid containing a sfGFP dropout | Synthetic construct | sfGFP dropout cassette inserted within the MCS of backbone, flanking with BsaI and BsmBI sites. Dropout cassette is replaced by target sequences, which enables to verify the insertion of target sequences if transformants do not express sfGFP. | tagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagagccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgcc |
| BBa_K4212066 | Vector | STK-1D-sfGFP | Destination plasmid containing a sfGFP dropout | Synthetic construct | sfGFP dropout cassette inserted within the MCS of backbone, flanking with BsaI and BsmBI sites. Dropout cassette is replaced by target sequences, which enables to verify the insertion of target sequences if transformants do not express sfGFP. | ttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagagccacgctcaccggctccagatttatcagcaataaa |
| BBa_K4212067 | Vector | STK-EXP-1-sfGFP | Plasmid for protein expresssion in B. subtilis. | Synthetic construct | The target gene was inserted in the vector, which could allow rapid, nontoxic selection of successfully transduced cells. | atgtgagaaacaaccaacgaactgttggcttttgtttaataacttcagcaacaaccttttgtgactgaatgccatgtttcattgctctcctccagttgcacattggacaaagcctggatttacaaaaccacactcgatacaactttctttcgcctgtttcacgattttgtttatactctaatatttca |