We searched gene sequences of PstS, PstC, PstA, PstB on NCBI and designed primers using SnapGene and verified by Primer 5.

① The PstSCAB part was extracted from the MG1655 genome using NEST PCR (To enhance the specificity).

② His Tag was added to the 5’ end of the PstB for the detection of the expressing protein.

③Adding homologous arms to both ends of the PstSCAB part: the homologous recombination sequence is introduced at the 5’ end of the primer to form the completely consistent sequence between the amplified product and the linearized cloning vector.

Results: After adding His Tag and homologous fragments, the pstSCAB gene is 3991bp long. PCR and the DNA sequencing results were correct.

The expression vector pET-28a (+) was used in this experiment.

①　Plasmid linearization

F: 5’-ctttaagaaggagatataccATGAAAGTTATGCGTACCACCGT-3’
R:5’-ttgttagcagccggatctcaTCAATGGTGATGGTGATGATGAC-3’

Results: After linearization, the linear pET-28a (+) plasmid is 5320bp long.

②　Constructing the recombinant plasmid using homologous recombination method

Gently mix the reaction solution and collect it to the bottom of the tube by brief centrifugation. Reaction at 37 Degree for 30min, then down to 4 degrees.

Material: competent DH5αstrain(QingKe Company), SOC medium,LB solid medium(including Kan resistance)
Method:
① Competent cells DH5αwere thawed on ice
② Add 10uL of recombinant product to 100 uL of competent cells, mix gently , and set on ice for 30 min.
③　After 42-degree water bath heat shock for 45s, immediately to cool tit on ice for 2-3 min.
④　Add 900uL SOC medium, rotate the bacteria about 200-250 rpm at 37 degrees for 1h
⑤　Take out the preheating plate (including Kan resistance) for plate coating
⑥　Inverted culture in a 37-degree incubator for 12-16 h

Material:LB liquid medium, PCR kit, Plasmid extraction kit
Method:
①　Colony PCR or Bacteria Liquid PCR
Select several clones on the recombinant reaction transformation plate for colony PCR identification/bacterial solution PCR. At least one universal sequencing primer of the vector shall be used for amplification primer, and the other primer can be used as the primer of the target gene. If the clone is correct, a stripe with a length slightly greater than the size of the inserted fragment should appear.
②　Plasmid extraction and PCR
If the colony is identified as positive by PCR, the remaining bacterial liquid can be inoculated into the LB liquid medium containing appropriate antibiotics for overnight culture, and the plasmid can be extracted for identification. The concentration of the plasmid is 171ng/mL, which can be used for subsequent transfomation.

Material:competent BL21 strain(QingKe Company), SOC medium, LB liquid medium, LB solid medium(including Kan resistance) , PCR kit
Method:The amplified recombinant plasmid was transformed into the BL21 strain for expression. The transformation method and identification method are the same as above.

①　Induction
Set two variables：the concentration of IPTG and the induced time.

②　Sample lysis

After induction, 4000 rpm, centrifugate for 15 min. Pour out the supernatant, suspend each tube with 5mL cold PBS, and crush it with ultrasonic crusher for 5-10min.

③Incubation

After crushing, take 1mL of crushed bacterial solution from each tube, add 50ul nickel medium, and incubate it for 2h at 4 degrees with rotation.

④Protein denaturation

Add 7.5uL SDS-PAGE Loading in each tube，boil at 100 ℃ for 10min.

⑤Loading and running the gel

7.5uL sample was loaded onto SDS-PAGE gel.Run the 5% stacking gel for 30min at 80V and run the separating gel for 1 h at 120 V.

⑥Western Blot

then electrophoresed and transferred to nitrocellulose membranes (0.2 µm), which were blocked with 5% non-fat blocking grade milk and incubated with the following primary antibodies overnight at 4 ℃: anti-His (1:2000). On the following day, wash the membrane in three washes of TBST, 10 min each. Then the membranes were incubated with the appropriate secondary antibody (1:10000) at room temperature for 1 h. Immunoblots were then visualized with chemiluminescence reagent kit.

Results:

His Tag is attached to the C segment of PstB protein, which is 257 AA and weighs 28 kD. There was no significant difference in expression between the experimental group and the control group after 2h and 4h induction. After 6 h induction, significant difference can be seen, and the experimental groups with the inducer IPTG concentration greater than 1 mM all have significant expression.

Verify the function of engineering bacterium.

1.First prepare the MOPS medium and LB medium.
2.Inoculate the engineering bacterium on LB medium till OD600=0.6~0.7.
3.Take 5 mL suspended solution then centrifuge the bacterial solution and take the sediment.
4.Add about 5mL MOPS medium to the sediment and resuspend it.
5.Repeat step 3&4 three times to wash the sediment to remove the residual LB medium.
6.Add MOPS medium to sediment up to 5mL and resuspend it. Then add 1mL 1mM IPTG solution and 5μL kanamycin.
7.Grow the engineering bacterium in the condition of 37℃, 220rmp for 4 hours to 6 hours. (Detect the phosphate concentration every half hour, the detection method is as follows.)

Method for detecting phosphorus concentration in bacteria.

1.Prepare 5% potassium peroxydisulfate solution, 20g/L ascorbic acid solution and 26g/L molybdate solution. (The methods to prepare them are as follows)
2.Take 5mL bacterial solution then centrifuge and take the sediment.
3.Add about 5mL deionized water to the sediment and resuspend it.
4.Repeat step 2&3 two or three times to wash the sediment.
5.Add a little bit of water (maybe 1 to 2mL) and resuspend it.
6.Move the solution to 15mL test tube with stopper and add deionized water to 10mL.
7.Add 1.6mL 5% potassium peroxydisulfate solution and tie the stopper tightly with gauze and thread (or other ways) and put all the test tubes into a beaker.
8.Heat the large beaker in a high-pressure steam sterilizer. When the pressure reaches 1.1kg/cm2 and the temperature reaches 120℃, keep it for half an hour and then stop heating.
9.Take 2mL solution obtained in step 8 to into a 50mL volumetric flask, then add 3mL 20g/L ascorbic acid solution and wait for half a minute. Then add 2mL 26g/L molybdate solution and set the volume to the scale with water.
10.Shake volumetric flask and set aside for 15 minutes.
11.Prepare a reference solution in the same way. (Just replace the solution in step 2 with deionized water)
12.Use the reference solution and sample solution to measure the light absorption at a wavelength of 710 nm

Results:

Purpose
To confirm the function of engineering bacteria, we designed a series of experiments and finally we concluded that the engineering bacteria which was transferred an additional Pst gene could absorb the phosphate more efficiently.

Data analysis

We have determined the cell concentration (CE), which was represented by the absorbance at the wavelength of 600nm (A(600nm)), and phosphate concentration (Cpi) in the supernatant after centrifugation, which was measured by ammonium molybdate spectrophotometry and expressed by the absorbance at the wavelength of 710nm (A(710 nm)). Here, the content of phosphoric acid, which is absorbed by the engineering bacteria, was expressed by the reduction of phosphate concentration (ΔCpi). In the meantime, due to the different experimental condition, it is impossible to ensure that each group of test samples will have the same bacterial concentration, so we divided ΔCpi by CE to show the influence of engineered bacteria on external phosphorus concentration.

results

In this part, we induced the overexpression of Pst system at the point that at the beginning of its logarithmic growth phase and the phosphate absorption capacity is lowest. We have found that the sample which is induced by IPTG grows slower than uninduced one and seems harder to reach the stationary stage (Figure 1). Based on this, we speculated that because the overexpression of Pst system will take up energy and nutrition that is also needed for growth and leads to a low cell concentration of engineering bacteria. What’s more, after adding 2mM IPTG for induction, the difference between experimental group and control group is becoming more and more apparent (Figure 2), and eventually stopped increasing then reached a balance after 8 hours of induction. If we use CE as the horizontal axis, we can also discover that obvious difference (Figure 3).This part has verified that the Pst system has successfully been transferred and could be induced and expressed successfully, and finally enhance the phosphate absorption capacity of the engineered bacteria.

Bacterial strains, Plasmids and Molecular experiments condition.

All strains and plasmids used in our study are listed in Table 1. Gene and protein sequences were obtained from the National Center for Biotechnology Information database ( https://www.ncbi.nlm.nih.gov ) , protein structure is obtained from the Protein Data Bank (https://www.rcsb.org) . The common PCR systems and procedures involved in the experiments are shown in Table 2.
The general method of plasmid amplification is to add 1-2 μl purified plasmid or 5-10 μL homologous recombination product to 100 μl competent cells, stand on ice for 30 minutes, then heat shock at 42℃ for 45 seconds, stand on ice for 2 minutes. Then add 1mL LB liquid medium into it for an hour and then place it on the corresponding resistant plate. After obtaining monoclones, plasmids will be extracted by TIANprep Mini Plasmid Kit (Tiangen).

Table 1. Strains and plasmids used in this study. Abbreviations: Ampr, ampicillin resistance; Kanr, kanamycin resistance; Cmr, chloramphenicol resistance.

Table 2. PCR system and program design using KOD enzyme. The amount of template DNA is chose by the concentration (0.1~100 ng for genomic DNA, 10 pg~50 ng for plasmid DNA), the extension time is 30 sec./ kb, anneal temperature is determined by primers.

Extract the wild-type ppk

Before subsequent experiments begining, we first need to obtain wild-type ppk from the genome of strain MG1655. The whole genomic DNA of strain MG1655 was first extracted using the Bacterial Genomic DNA Extraction Kit (Tiangen). E.coli is grown overnight in LB at 37°C with shaking at 220 rpm. Then, we take 4mL of the bacterial solution to centrifuge (2 min at 10000 rpm and room temperature) , add 200μL GA buffer, 20μL Proteinase K, 220μL GB buffer to the precipitation and shake for 15 sec. The solution is left in a water bath at 70°C for 10 min, at which point it will become clear and bright.
Then, we add 220 μL of anhydrous ethanol, mix it and add all the resulting solution and flocculent precipitate into the adsorption column, rinse it twice with PW buffer (30 sec at 12000 rpm) and dry well. Next, the resulting genomic DNA will be collected by fully eluting with 50 μL sterile H2O.
Finally, we use the extracted genomic DNA as the template for PCR, primers were designed using snapgene (https://www.snapgene.cn)、vazyme (https://crm.vazyme.com/cetool/tmcal.html) and primer 5. To facilitate subsequent expression verification, the his tag sequence (GTGGTAGTGGTAGTGGTA) is added at the 3' end. The primer sequences used are shown in Table 3.

Table 3. The primer sequence of wild-type ppk amplification. The part marked in red was 6*His Tag sequence, and Tm value only calculate the annealed base part.

Point mutation of ppk

We tried to use two different methods to mutate the wild-type ppk. (Noting: all the primers mentioned here can be found in Table 4.)

Method one:

We use the pET-22b(+) plasmid, linearize it using reverse PCR [22b-linear-5’ and 22b-linear-3’], then ligate the linearized plasmid with the wild-type ppk containing homologous arms [22b-rec-5’ and 22b-rec-3’] using homologous recombinase to construct a homologous recombinant plasmid called pWTppk containing wild-type ppk.
Since the mutation site we wanted is located at position 713 of the ppk gene, which has a high AT content in the nearby sequence, and the primers designed around it is prone to form hairpin structures and dimers, which are not easy for direct point mutation. So we amplify a small fragment of 500 bp in length from the recombinant plasmid pWTppk using primers containing the mutation site [ppk-mut-5’ and ppk-mut-3’], at this point we can obtain a gene sequence containing the mutation site we wanted.
Next, a new plasmid pMUTppk containing the mutation site will be obtained by homologous recombination (include linearizing the plasmid at the corresponding position [MUREC-lin-5’ and MUREC-lin-3’], the corresponding homologous arm is included in the primer [ppk-mut]).
At last, use the corresponding amplification primers [ppk-amp-5' and ppk-amp-3'] to amplify ppk containing the point mutation from the plasmid pMUTppk. At this point, the ppk point mutation is complete.

Method two:

This method uses overlap PCR to directly mutate linear ppk fragments, the principle of which is shown in Figure 3. The primers used [overlap-5p1,3p1,5p2,3p2] are shown in Table 4.

Figure 3. The principle of overlap PCR

It should be noted that the products of the first two rounds of PCR need to be added first in the third round, then add ppk amplification primers [ppk-amp-5' and ppk-amp-3'] after about 10 rounds of reaction for amplification, otherwise it will easily cause trailing or hanging holes, resulting in poor concentration of the obtained products. See below for detailed protocol.

Performing point mutation through overlap PCR

The overlap PCR is achieved through two steps of PCR reactions.

(1)Amplification of overlap fragments

The wild type ppk CDS sequences is separated into two overlap fragments through PCR process:

ppk CDS	0.5μL
5’primer	2.5μL
3’primer	2.5μL
PCR Mix	25μL
ddH2O	19.5μL

After amplification, two fragments are used to be the template as well as primer.

(2)Ligation of two fragment

PCR program:

Fragment A	1μL
Fragment B	1μL
2×PCR buffer	25μL
2mM dNTPs	1μL
DMSO	2.5μL
ddH2O	14.5μL
DNA polymerase mixture	1μL

Step	Temperature	Time
Predegeneration	95℃	3min
Degeneration	95℃	15sec
Anneal	62℃	15sec
Extend	72℃	1min
[Go to degeneration step to circulate 15 times]
Full extension	72℃	5min
Heat preservation	4℃	∞

Amplification of mutated ppk CDS sequences
The PCR tube is placed on ice immediately after the first program. A PCR reaction aiming at ppk CDS amplification is performed.

ppk CDS	0.5μL
5’primer	2.5μL
3’primer	2.5μL
PCR Mix	25μL
ddH2O	19.5μL

Step	Temperature	Time
Predegeneration	95℃	3min
Degeneration	95℃	15sec
Anneal	52℃	15sec
Extend	72℃	1min
[Go to degeneration step to circulate 15 times]
Full extension	72℃	5min
Heat preservation	4℃	∞

Table 4. The primer sequence of point mutation of ppk. The blue part is the homology arm, the red part is the mutation site.

Knock-out of wild-type ppk on the genome

Since PPK is a tetrameric protein, transforming mutant ppk into wild-type strain directly is likely to cause the wrong arrangement of protein monomers, making ppk unable to play its proper role. Therefore, our project chose to first use lambda red homologous recombination technique to knock out the original wild-type ppk on the genome. Here are three main steps.

Step one:

First of all, we prepared the electrocompetent MG1655 cells and transformed the plasmid pKD46 into it. The detailed protocol is as followed.
(1) Inoculate 500 uL of a fresh overnight E. coli culture into 50 mL of LB liquid medium.
(2) Grow the cells at 37°C shaking at 225 rpm to an OD600 of approximately 0.5 -0.7.
(3) Chill the cells on ice for ~20 min. For all subsequent steps, keep the cells as close to 0°C as possible (in an ice/water bath) and chill all containers in ice before adding cells. Transfer the cells to a sterile, cold 50 mL centrifuge bottle and centrifuge at 4000 rpm for 15 minutes at 4°C.
(4) Carefully pour off and discard the supernatant. It is better to sacrifice yield by pouring off a few cells than to leave any supernatant behind.
(5) Gently resuspend the pellet in 50 ml of ice-cold 10% glycerol. Centrifuge at 4000 rpm for 15 minutes at 4°C; carefully pour off and discard the supernatant.
(6) Resuspend the pellet in 25 mL of ice-cold 10% glycerol. Centrifuge at 4000 rpm for 15 minutes at 4°C; carefully pour off and discard the supernatant.
(7) Resuspend the pellet in 2 mL of ice-cold 10% glycerol. Centrifuge at 4000 rpm for 15 minutes at 4°C; carefully pour off and discard the supernatant.
(8) Resuspend the cell pellet in a final volume of 100-200μL of ice-cold 10% glycerol.
(9) This suspension may be frozen in aliquots on dry ice and stored at -80°C. The cells are stable for at least 6 months under these conditions.
(10) Before we carry out the electroporation, place a 1.5 ml microfuge tube and a 0.1 cm electroporation cuvette on ice, and place a 17 X 100 mm tube with 1 ml of SOC at room temperature. To the cold, 1.5 ml polypropylene microfuge tube, add 20 μl of cell suspension and 2 μl of DNA. Mix well and incubate on ice for ~1 minute.
(11) Transfer the mixture of cells and DNA to a cold electroporation cuvette and tap the suspension to the bottom. Place the cuvette in the ShockPod. Pulse once at 1.8 kV, 5.9 ms.
(12) Remove the cuvette from the chamber and immediately add 1 ml of SOC medium to the cuvette. Quickly but gently resuspend the cells with a Pasteur pipette.
(13) Transfer the cell suspension to a 17 X 100 mm polypropylene tube and incubate at 30°C for 1 hour, shaking at 225 rpm. Plate on L B plates with ampicillin. As a result, the MG1655 strain containing the pKD46 plasmid will be obtained. * Since pKD46 is a temperature-sensitive plasmid that cannot replicate at 37°C, all strains containing it need to be cultured at 30°C.

Step two:

Using PCR to amplify a kanamycin gene fragment from plasmid pET-28a(+) with homologous arms at both ends [28a-kan-5’ and 28a-kan-3’, see sequences in table 5]. The homologous arm should be identical to the both ends of wild-type ppk sequence on the genome, with a length of about 15 nt.

Step three:

The bacteria obtained in the first step should be used to reprepare the electrocompetent state into which a linear fragment of kanamycin will be transferred (condition: 2.5kV, 5.9ms). Then, with the help of the pKD46 plasmid (Figure 4), a linear fragment of kanamycin was integrated into genomic DNA to replace the wild-type PPK at the corresponding position. Thus, we could obtain the wild-type PPK knockout strain.

1.Acquisition and point mutation of wild-type ppk

Figure 1. Wild-type and mutant ppk are checked with agarose electrophoresis gel. A theoretical gel is presented on the right of each gel.

As shown in the Figure, 1 is the wild-type ppk we amplified by PCR from the genome of MG1655 strain, 2 to 4 are overlap PCR results. 2 is fragment A to the left of the mutation site, 3 is fragment B to the right of the mutation site, fragments A and B were used as template and primer for each other, and the final mutant A719G was amplified, i.e. 4.
The length of both wild-type and mutant ppk is 2085 base pair. Due to an overlapping segment of the primer design, fragment A and fragment B add up to a length greater than 2085.

2.Screening of mutants

Figure 2. Mutant screening by PCR amplification. A theoretical gel is presented on the right of each gel.

After performing wild-type ppk knockout on the genome and transformation of the plasmid containing mutant ppk, we picked five monoclonal clones from plates with kanamycin and chloramphenicol dual resistance, extracted the whole genome separately and then amplified them from both ends of the ppk sequence using primers without His Tag to perform preliminary screening for mutants.
The PCR amplification results of genomic DNA from five monoclonal clones are shown in 1 to 5. 1-3 have shallow ppk bands, which might be caused by incomplete wild-type ppk knockout. Hence, we selected 4 and 5 for further validation.

Figure 3. Using the two mutants screened above for initial functional validation. See wet lab_experiment for details of the validation method.

In this experiment, we inoculated the above two mutants into LB medium and centrifuged (4000 rpm, 10 minutes, at room temperature) until the growth density was approximately the same. Then we washed twice with sterile water and resuspended by adding MOPS minimal medium, continued to incubate (37°C, 225 rpm) and the growth density and phosphorus concentration were measured hourly starting from 4 h after resuspension.

A(710 nm) reflects the phosphorus content in the supernatant, and the higher it is, the more phosphorus is in the liquid. In the results processing, we subtracted the actual phosphorus concentration from the initial phosphorus concentration and divided it by the growth density, thus reflecting the ability of the bacteria to absorb phosphorus during that period of time.

From the results we can see that mutant 2, although it absorbed phosphorus faster (the supernatant phosphorus concentration after 4 hours of incubation was significantly lower than that of the wild-type after 8 hours of incubation), was not stable and rebounded after 4 h. Mutant 1 also had some ability to absorb phosphorus and was more persistent. So in the subsequent experiments, we first selected mutant 1 for functional verification. The mutant strain were saved as glycerol stock.

3.Validation of expression

Figure 4. Results of two SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining.
Figure A, from right to left, shows the induction of the mutant bacterium for 2, 4, and 6 h by adding 0.6 mM IPTG to the mutant broth incubated for a certain time.
Figure B, from right, 7th is wild type, 6 to 4 is mutant which has been inducted for 2, 4 and 6 h, 3 to 1 is a ppk overexpressing MG1655 strain (Transforming plasmids containing wild-type ppk gene into wild-type E. coli) which has been inducted for 2, 4 and 6 h. The molecular weight of PPK is 80 kDa, and the brightest band of the marker we used is located at 75kDa.
As shown by the staining results, both wild-type PPK and mutant PPK appeared to be well expressed in MG1655 strain, and the expression level increased with induction time.

4.Validation of function

Figure 5. Relationship between bacterial growth density and phosphorus concentration at different IPTG concentration gradients.
Before the formal experiments for functional validation began, we performed an initial pre-experiment with a gradient of IPTG concentration, hoping to select a more appropriate induction concentration. In the same way as the experiments mentioned in the second section, we used MOPS minimal medium to resuspend and then measure phosphorus concentration and growth density every hour. We chose 0.2mM, 0.6mM, 1mM and 2mM concentration to compare with the wild-type, respectively.
It is worth mentioning that since we found a large difference in the growth rate between the mutant and wild-type at the same time (see in Figure 6), we chose to plot the growth density versus phosphorus concentration to compare the ability of E. coli to absorb phosphorus under different conditions.

Figure 6. Comparison of growth turbidity in LB.
A and B were grown in LB for 12 h. A was the mutant and B was the wild-type;
C and D were grown in LB for 24 h. C was the wild-type and D was the mutant;
The growth rate of the mutant and wild-type is very different at both 12 and 24 hours, and is more pronounced at 24 hours.

From Figure 5 we can observe that the phosphorus concentration in the supernatant of the mutant was significantly lower than that of the wild-type when the IPTG concentration was 0.6 mM, and the growth of bacteria was faster compared with the other groups. Therefore, we selected the IPTG concentration of 0.6 mM for induction in the formal experiment.

Figure 7. Functional verification formal experiments.

In the formal experiments, we inoculated MG1655 wild-type, MG1655 overexpressing ppk and mutant strains into the same volume of MOPS minimal medium, and measured the growth density and phosphorus concentration every half hour until the bacteria grew to the plateau stage.
As seen from the experimental results, the bacteria overexpressing ppk grew to an OD600 of about 0.6 and then showed a more pronounced phosphorus uptake compared to the wild-type strain, with a significant reduction in the phosphorus concentration in the supernatant.
In contrast, the phosphorus uptake of the mutant was very obvious at the early stage of growth, and the phosphorus concentration in the supernatant at an OD600 of about 0.4 was already relatively the same as that of the wild-type at an OD600 of about 0.9.
Thus, we can see that by modifying the ppk gene, the mutant strain has a very obvious rapid phosphorus uptake ability. However, at the same time, the phosphorus concentration rebounded in the middle and late stages of mutant growth, indicating that this ppk mutant might have some toxicity, which can also be improved in subsequent experiments.

5’-GTGTTAACGCTGCTTCACCTGCTTTCTGCCGTCGCCCTGCTGGTCTGGGGGACTCATATTGTTCGAACCGGCGTAATGCGCGTCTTCGGCGCGCGTTTGCGTACTGTCCTTAGCCGGAGCGTCGAAAAAAAGCCGCTCGCCTTTTGCGCGGGGATCGGCGTTACCGCACTGGTACAGAGCAGTAATGCCACCACCATGCTGGTGACCTCGTTTGTCGCTCAGGATCTGGTAGCCCTCGCACCGGCTCTGGTCATTGTGCTGGGTGCAGATGTCGGGACGGCGCTAATGGCGCGTATTCTCACCTTCGACTTATCCTGGCTGTCACCGTTACTTATTTTTATCGGCGTGATTTTTTTCCTCGGACGCAAACAGTCACGCGCCGGGCAACTGGGCCGCGTCGGTATTGGTCTTGGGCTGATTTTGCTAGCGCTGGAGTTGATTGTGCAGGCCGTAACGCCGATCACCCAGGCAAACGGCGTTCAGGTGATCTTTGCCTCGCTGACCGGCGATATTCTGCTGGATGCGCTGATTGGCGCGATGTTCGCCATTATCAGCTACTCCAGCCTTGCTGCTGTACTGCTGACCGCGACTCTGACCGCCGCAGGCATTATCTCCTTCCCCGTGGCGCTCTGTCTGGTGATTGGTGCTAACCTCGGTTCCGGTCTGCTGGCAATGCTCAACAACAGTGCCGCCAATGCCGCAGCCCGCCGTGTCGCGCTGGGTAGTCTGCTGTTTAAGCTGGTGGGTAGCCTGATTATCCTGCCGTTTGTCCATTTGCTGGCAGAGACAATGGGGAAGTTGTCATTGCCAAAAGCGGAACTGGTGATCTATTTCCACGTCTTCTACAACCTTGTACGTTGCCTGGTCATGCTGCCATTTGTTGACCCGATGGCACGGTTTTGCAAAACGATTATTCGCGATGAACCGGAACTGGATACCCAGCTACGGCCTAAACATCTGGATGTCAGCGCGCTGGATACGCCCACGCTTGCTCTGGCGAACGCCGCGCGCGAAACCCTGCGCATTGGCGACGCCATGGAACAGATGATGGAAGGGTTGAATAAAGTGATGCACGGTGAGCCACGGCAGGAGAAAGAGCTGCGTAAGCTGGCAGATGATATCAACGTTCTCTACACCGCCATTAAGCTGTATCTGGCGCGGATGCCAAAAGAAGAGCTGGCGGAGGAAGAGTCGCGCCGCTGGGCAGAGATCATCGAAATGTCGCTCAACCTTGAACAGGCCTCCGATATCGTCGAGCGCATGGGCAGCGAAATTGCTGACAAATCACTGGCAGCACGGCGGGCATTTTCGCTTGATGGGTTGAAGGAACTGGATGCGCTCTATGAGCAATTGCTCAGTAATTTAAAGCTGGCAATGTCGGTGTTCTTCTCTGGCGATGTCACCAGCGCTCGTCGTTTGCGTCGCAGCAAACATCGTTTTCGCATTCTTAATCGCCGCTATTCCCACGCCCACGTCGATCGCCTGCATCAGCAAAACGTGCAGAGCATTGAAACCAGTTCGCTACATTTAGGCTTACTGGGAGATATGCAGCGCCTGAACTCGCTGTTTTGTTCGGTGGCTTACAGTGTGCTGGAACAGCCGGATGAAGATGAAGGACGGGACGAGTATTAA-3’

1. Wet lab experiments

A.Build the vector
1.Acquisition of the element genes

The yjb B gene was amplified from the M G1655 wild-type strain by two primers, y jbB-5’ and yjbB-3’.
2.Gene transformation of elements

Cutting sites were added at both ends of the yjbB gene to obtain the Xbal-yjbB-Xhol gene fragment.
3.Build the plasmid
    3.1Construction of the functional validation plasmids
    Cutting site: Xbal/Xhol
    The Xbal-yjbB-Xhol fragment was ligated by double digestion on the pET-22b (+)
    vector to generate the pET-22b (+) -yjbB plasmid
    3.2

B. Construction of the protein validation plasmids

The homologous arms were amplified by yjbB-his-amp-5’ and yjbB-his-amp-3’ primers and pET-22b (+) plasmid with yjbB and yjbB-his-line-line-3’ to generate the pET-22b- (+)-yjbB-his plasmid with the its tag C. Expression was performed using the construction of the transformed strain
All strains used BL21 commercial protein. During the construction of the plasmid, we constructed the yjbB gene downstream of the pET-22b (+) plasmid T7 promoter, so the expression and function will be verified by IPTG as the inducer. D.Functional validation method
The yjb B-BL21 strain was amplified to about O D600=0.6 in L B medium containing 1 / 1000 ampicyl resistance, induced protein expression with 0.1mM IPTG for 2 hours, washed twice with phosphorus-free MOPS medium, and continued induction with 0m M IPTG to measure the supernatant phosphorus concentration over time (1-7 hours) and OD value (0.1 per increase). E.Protein expression validation

The yjbB-his-BL21 strain was amplified to around O D600=0.6 in LB medium containing 1/ 1000 ampicyl resistance, and IPTG was added as indicated to induce protein expression

Protein expression was detected by centrifugation, washed twice with PBS, resuspended with 4ml PBS, lysed on ice using an ultrasonic crusher, incubated with 1 ml of protein samples with 40 microliters of nickel medium for 2 h, centrifuged at 4℃ 12000rpm for 15 min, supernatant was removed, 40 microliters of PBS was resuspended, and the resulting samples were subjected to SDS-PAGE.

①PCR system

The PCR reaction procedure

② phospho-free M OP s medium

③LB culture medium

2.Wet lab results

A. Gene sequence acquisition
1. Results of pET-22b (+) -yjbB sequencing (primers: YjbB-2-5′, YjbB-2-3′)

2. Results of pET-22b (+) -yjbB-his sequencing (primers: yjbB-his-amp-5 ′, yjbB-his-amp-3 ′)

B. Verification of the protein expression
C. protein function verification (haven’t finished yet )

Fig | When BL21-yjbB and wild-type BL21 grow in LB culture medium until OD600 is about 0.7, IPTG was added until the final concentration was 2mM and the bacteria are induced for 2 hours. The bacteria were resuspended in 50ml phosphate-free medium, and 2mM IPTG was added to continue induction. Then, measure the change of phosphate concentration in the culture medium with the increase of time.
During the whole induction process, the turbidity of bacteria in the experimental group hardly changed. The concentration of phosphate in wild type group is basically maintained at a stable value. From the fifth hour, the phosphate concentration in the culture of the experimental group was much higher than that of the wild type group, and increased significantly with time.

The sequence of the cI857,R promoter,phlF,phlF promoter are obtained from the literature written by professor Guoqiang Chen. We use "Snapgene" to design the plasmid and sent it to the biological company for synthesis.

1.Construction of PphlF-eGFP plasmid

①Use PCR to extract eGFP from PJG186-GFP plasmid

②Recombination of eGFP into PphlF plasmid by homologous recombination

Results: The sequencing result is no problem.

2.Construction of cI857-PR-phlF-mCherry plasmid

①Use PCR to extract mCherry from PGH188-mCherry plasmid
Primer2-5：5’-ATCATCACCACCATCACTTAatggtgagcaagggcgagg-3’
Primer2-3：5’-GGTGGCAGCAGCCTAGGTTAtcacttgtacagctcgtccatgc-3’
②Recombination of mCherry into cI857-PR-phlF plasmid by homologous recombination

③Electrophoresis to verify whether homologous recombination succeed
Results: There are bands at about 750bp. It is preliminarily determined that mCherry is successfully restructured,and the sequencing result is no problem.

3.Electrophoresis to verify whether each element of plasmid exists

①Take out cI857 for test by PCR

②Electrophoresis to verify
Results:There is band at about 750bp. It is preliminarily determined that cI857 is exist.

4.Transfer the two plasmids into the same strain

①Transformation and electrophoresis to verify
Results:The band is between 6000 and 8000 bp, and our cI857-PR-phlF-mCherry plasmid is about 7000 bp, and the sequencing result is no problem.

②Electrokinetic

5.Culture

①Time gradient: 6h 8h 12h 24h
②Temperature gradient: 30℃ 33℃ 37℃ 42℃

6.Result

Fig | First, we cultured the genetic-modified E.coli which contains thermal-sensitive regulation circuits at 30 ℃,33 ℃,37 ℃and 42 ℃. From the fluorescence data corresponding to our thermal gradient, the red fluorescence expression was very weak at the temperature range of 30 ℃ to 34 ℃, indicating that the dimer formed by cI857 inhibited the R promoter at this time, leading to the subsequent weakening of mCherry expression; The strong red fluorescence expression at 37 ℃ to 42 ℃ indicated that cI857 dimer depolymerized and the inhibition of R promoter was relieved, and then mCherry was normally expressed.
In order to determine the better culture time, we selected the values of 12h and 15h for comparison.We found that there was little difference between the absorbance of 12h culture and 15h culture, and even 15h would decrease under some temperatures, so we chose the final culture time of 12h.
That is, the temperature sensitive control element cI857 is controlled by thermal signal.