Experiments

  1. Design primer using Snapgene with Helicobacter pylori, Salmonella Typhimurium, and Shigella Flexner’s genome as templates. 10 templates will be designed in total. See the chart below for more details:
    Bacteria Origin Number of primers
    Primer-F Primer-R Target Sequence(s)
    H. Pylori 2 2 cagA, 16S
    S. Typhimurium 1 1 invA
    S. flexneri 1 1 ipaH
    Francisella tularensis subsp. novicida FTG 1 1 FnCas12a

See primer sequences as attached.

(BBa_K4304021; BBa_K4304022; BBa_K4304023; BBa_K4304024; BBa_K4304025; BBa_K4304026; BBa_K4304027; BBa_K4304028; BBa_K4304029; BBa_K4304030)

See plasmid report from Genscript Biotech attached.

  1. Take out five 50μl E. coli BL21(DE3) competent cells from the -80℃ fridge and place them on ice. Wait for 5 minutes until the competent cells unfreeze.
  2. In each of the five microtubes, add in 3μl 50ng/μl of the plasmids (16S_pUC57, ipaH_pUC57, invA_pUC57, cagA_pUC57, Cas12a_pET-28a). Set it aside for 25 minutes.
  3. Place the microtube in a 42℃ water bath and heat shock for 45 seconds.
  4. Place the tube back on the ice for 2 minutes.
  5. Add 700μl lysogeny broth (LB) into each of the tubes and incubate at 200 rpm for 60 minutes.
  6. Centrifuge at 5000 rpm for 2 minutes and coat on LB medium plates.
  1. Plate all 5 E. coli strains on the LB medium plates, respectively (Cas12a strain on the plate with Kana antibiotics and the other 4 plates with Ampicillin antibiotics)
  2. incubate overnight and use a pipette to pick a single colony of E. coli
  3. inoculate single colonies in 3ml LB. A total of 5 flasks will be prepared, incubate overnight at 37℃, 200rpm.
  1. Prepare one 500 ml (to culture Cas12a E. coli)and three 300ml LB(To culture four colonies of GM E. coli with different integrated template sequences*****, each trial requires 25ml, the excess will be on standby)
    Weigh the following reagents with an electronic balance and add them into 4 conical flasks using a spatula in the following sequence:
    Tryptone* 5 g 3 g
    Yeast extract** 2.5 g 1.5 g
    NaCl*** 5 g 3 g
    Suspend with ddH2O**** until the volume reaches 500 ml 300 ml
    *Tryptone is used to provide essential amino acids such as peptides and peptones to the bacteria
    **Yeast Extract provides a range of organic compounds for bacteria growth
    ***Sodium chloride balances osmotic pressure and provides sodium ions for the bacterium
    ****ddH2O: double distilled water
    *****four types of template sequences:
    Name of the sequence Originates from
    16S Helicobacter pylori
    cagA Helicobacter pylori
    invA Salmonella typhimorium
    ipaH Shigella flexneri
  2. Autoclave all LB (lysogeny broth)
    *No need to adjust the pH as both sodium hydroxide and TRIS buffer are usually unnecessary.
  3. Allocate 150ml autoclaved LB into two equal aliquots, each 75ml.
  4. Add 75μl of Kan+ antibiotics into one flask, and 75μl of Amp+ antibiotics into the other (as the volume ratio between LB and antibiotics should be 1000:1). Label the flasks.
  5. Prepare 4 sets of cell culture tubes, each with 3 tubes.
  6. In each group of tubes, allocate 5ml of Amp+ LB into one tube,and 5ml Kan+ LB into the other two.
  7. Inoculate bacterium (Add 50μl of E. coli-containing-medium into each tube, ending up with four tubes with four different types of GM E. coli), and label the date, its antibiotics, and integrated sequence on the tube. The number and types of cell culture tubes are recorded in the table below:
    Integrated sequence Plasmid name Corresponding antibiotics Number of tubes
    Cas12a pET-28a Kan+ 8
    16S pUC57 Amp+ 1
    cagA 1
    invA 1
    ipaH 1
  8. Place all tubes in the shaker rock for 16 hours, allow it to proliferate

6.1.1 Transfer cas12a-containing E. coli for reproduction at a greater scale

Purpose: For greater amount of E. coli cloning
Reagents: LB, antibiotic K+, Cas12a containing E. coli
  1. Prepare 3 conical flasks, each holding 150ml of LB medium
  2. Add 150μl of antibiotic K+ into each flask using a pipette (note: add after the K+ solution fully melts, as it was previously frozen)
  3. Add 5μl bacterial solution that contains Cas12a into each flask (while the normal ratio of E. coli to LB is 1:1000, we increased the ratio to accelerate the speed of bacterial cloning at a greater scale)
  4. Place the flasks into a shaker and incubate for 5 hours

6.1.2. Measure OD value of E. coli (dedicated to inducing Cas12a protein expression)

Purpose: Check if the concentration is suitable for the addition of IPTG
Reagents: LB, antibiotic K+, Cas12a containing E. coli
  1. Wipe off any residues on the Nanodrop from previous users with lens paper
  2. Add 1μl of LB onto the probe using a pipette as the control group.
  3. Run the test (by selecting the “nucleic acid” option)

6.1.3. Addition of IPTG

Purpose: Promote the transcription of Cas12a proteins in E. coli colonies in different IPTG environments while also allowing comparison
Reagents: LB, IPTG
  1. Add 30μl of IPTG into flask 1 (containing 150ml LB and E. coli), creating a concentration of 0.2μM/μl
  2. Add 75μl of IPTG into flask 2 (containing 150ml LB and E. coli), creating a concentration of 0.5μM/μl
  3. Add 120μl of IPTG into flask 3 (containing 150ml LB and E. coli), creating a concentration of 0.8μM/μl

6.2.1. Purify Cas12a Protein

  1. Collect E. coli bacteria
    Purpose: to separate it from LB
    1. Centrifugation the bacteria medium at 4000 rpm
    2. Discard the supernatant
  2. Suspend E. coli within Buffer A
    1. Add 5 ml of Buffer A into the sediments, allow the biomass to float
  3. Ultrasound Cell Lysis of E. coli
    Purpose: Break the bacteria membranes so that Cas12a proteins can be extracted and purified
    1. Place the entire sample on ice (maintain a temperature of 4 °C to preserve its proteins) and place it into an ultrasound cell crusher.
    2. Set the total time as 10 minutes and the interval as 5 seconds (to close for 5 seconds every time the system worked for 5 seconds). The power ratio should be at 70%.
  4. Centrifugation of Ultrasound Results
    1. Place the sample in the centrifuge. Set the system at 4000 rpm, 20 minutes, 4 °C.
    2. After centrifugation, extract the supernatant (containing CAS 12a proteins)

6.2.2. Nickel affinity purification of Cas12a protein

Principle: The 6×His tail of Cas12a protein is strongly attracted to the nickel column, therefore will not be washed down by Buffer A but will be washed down by Buffer B. Whereas other proteins, attach more firmly or less firmly than the Cas12a, thus will be cleaned by adding Buffer A or will not be washed by Buffer B.
  1. Mix the reagents below in the assigned portion as shown in the chart to obtain 0.5 L His buffer A
    Buffer A: 0.5L
    Ingredients
    20 mM Na2HPO4.2H2O 1.78 g
    500 mM NaCl 14.6 g
    20 mM Imidazole 1.02 g
    HCl (6M) until pH reaches 7.4 and the volume reaches 0.5L
  2. Mix the reagents below in the correct portion as mentioned in the chart below and obtain 0.25 His buffer B
    Buffer B: 0.25L
    Ingredient
    20 mM Na2HPO4.2H2O 1.89 g
    500 mM NaCl 7.3 g
    500 mM Imidazole 8.5 g
    HCl (6M) until pH reaches 7.4 and the volume reaches 0.25L
  1. Complete installing the nickel affinity purification system by stacking the nickel column onto a new microtube. Then, place it on ice.
  2. Using a pipette, add 4 times the nickel column’s size worth of Buffer A to moist the column. Collect one tube of the solution under the nickel column and label it as the “first filter”.
  3. Add the supernatant into the nickel column. Decant slowly and gradually. Keep the velocity of the flow at 1ml/min.
  4. Add 6 ml of Buffer A into the nickel column. Keep the velocity of the flow at 1ml/min.
  5. Collect one tube of the solution under the nickel column and label it as the“last filter”.
  6. Repeat step 4 for two more times.
  7. Add 3 ml of Buffer B into the nickel column. Keep the velocity of the flow at 1ml/min.
  8. Collect two tubes of the solution under the nickel column and label them as “Cas12a protein #1” and “Cas12a protein #2” respectively. They are the target protein.
  9. Add 2 ml of His Buffer B into the nickel column.
  10. Collect one tube of the solution under the nickel column and label it as “Buffer B elution”.
  11. Add 5 ml of Buffer A into the nickel column.
  12. Collect one tube of the solution under the nickel column and label it as “Buffer A elution”.
  13. Wash the nickel column by decanting 10ml of His buffer A and 5ml 20% ethanol

6.2.3. Measure the concentration of Cas12a protein in the resultant solution

  1. Wash off any residue on the NanoDrop using ddH2O.
  2. Add 2μl of Buffer B onto the probe using a pipette (As the negative control group). Record the protein concentration. Wash off any residue on the NanoDrop.
  3. Add 2μl of “Cas12a protein #1” solution onto the probe using a pipette. Record the protein concentration. Wash off any residue on the NanoDrop.
  4. Add 2μl of “Cas12a protein #2” solution onto the probe using a pipette. Record the protein concentration. Wash off any residue on the NanoDrop.
Purpose: To test the content and purity of the extracted Cas12a proteins
Material: Protein 40μl, 4× Loading buffer 10μl, 7 microtubes

6.3.1 Protein Electrophoresis preparation (1mm thick mm gel)

  1. In a sterile cup, add 2ml of 2× gel solution A and 2ml of gel solution B
  2. Using a pipette add 55μl TEMED, and gently swirl the cup until all reagents are fully mixed
  3. Add the mixture gently, aware not to introduce any gas bubbles
  4. Add ethanol using a pipette until the liquid level reaches the top
  5. Wait for 6 to 10 minutes at room temperature, and allow the separating gel to solidify. After the gel solidifies, dispose of the ethanol.
  6. Mix 0.75ml 2× upper gel solution A and 0.75ml 2× colored upper gel solution B (red) and 15μl TEMED in a sterile cup, gently swirl the cup
  7. Gently pour the mixture between two glass plates (mold) and insert a comb on the top
  8. Wait for 10-15 minutes until the stacking gel solidify.
  9. Extract the comb.

6.3.2. Protein electrophoresis of Cas12a proteins

  1. Use a pipette to inject 40μl of protein into each of the seven microtubes in the order of nickel column filter.
    1. first filtrate
    2. last filtrate
    3. Cas12a1
    4. Cas12a2
    5. Buffer B
    6. Buffer A
    7. Bacteria sediment (obtained from the residue in “purifying Cas12a proteins”)
  2. Add 10μl of 4× loading buffer into each of the seven microtubes
  3. Then put the tubes into a 100℃ metal bath for 10 minutes. This is to break the bonds in proteins and disrupt their complex dimensional structures so that they will travel in a regular route during the electrophoresis.
  4. Make Tris-Glycine SDS buffer by mixing the following reagents.
    • 1 pack of Tris-Glycine SDS buffer powder
    • 1L ddH2O
  5. Fill the middle cell in the protein electrophoresis machine with Tris-Glycine SDS buffer, and let it evenly overflow into the two cells on the side. Make sure the water level in the outer cells exceeds half of the container’s size.
  6. Make sure the positive and the negative electrodes are plugged in correctly.
  7. Add 20μl of the sample protein (7 samples in total) into separate tubes carefully.
  8. Add three markers at 20μl, to fill in all wells and ensure each tube has the same weight.
  9. Start the electrolysis with a setting of 180V, for 45 minutes.
  10. When the machine is turned on, air bubbles should travel upwards (opposite from the electrical current).
  11. After the electrolysis, use Coomassie brilliant blue to stain the protein gel (that contains the seven samples), which then visualizes the protein traces after destaining.
  12. Put the dyed protein gel onto the horizontal oscillator and incubate for 90 min.
  13. Wash the protein gel using Coomassie brilliant blue decolorizing solution and soak it in the same solution for 18 hours
  14. Place gel into GenoSens 2000 Gel Documentation and Analysis System to collect results.

6.3.3. BCA test of Cas12a proteins’ concentration

  1. Dilute 20μl 5mg/ml BSA standard solution with 250μl DD water into a beaker to produce 0.04μg/ml BSA standard protein solution
  2. In 9 of the wells on the lightproof microplate, add 100μl BCA reagent and 100μl standard protein solution
  3. In 2 of the wells on the lightproof microplate, add 100μl BCA reagent and 100μl sample Cas12a protein solution
  4. Incubate the reagents in a gradient thermal cycler at 37 °C for 30 minutes.
  5. Test using Subtract max

7.1.1. Plasmid extraction

Reagents: LB culture medium, Buffer S, Buffer SP1(50 mM glucose / 25 mM Tris-HCl/ 10 mM EDTA,pH 8.0, RNase A), Buffer SP2(0.2 N NaOH / 1%SDS), Buffer SP3(Potassium Acetate/2M acetic acid/75% alcohol)
Purpose: To purify and isolate pUC57 plasmids from E. coli colonies
  1. Extract 1ml of all four E. coli inoculum (excluding cas12a) from the test tubes on the clean bench; preserve them in separate tubes for future experimentation. To the remaining test tubes of each E. coli solution (4ml left in each):
  2. Separate solutions into two 2ml microtubes; centrifuge the microtubes at 8000×g for 2 minutes.
  3. Discard the supernatant.
  4. Add 50 μl buffer S* to each spin column.
  5. Centrifuge the spin column at 12000 ×g for 1 minute.
  6. Add 250 μl buffer SP1 to the microtubes; resuspend the pelleted bacterial cells using a pipette.
  7. Add 250 μl buffer SP2 to the microtubes; mix the tubes backward very slowly and gently 6 times.
  8. Add 350 microliters of buffer SP3; mix the solutions in the same way as in step 7.
  9. Centrifuge the microtubes at 12000 ×g for 10 minutes.
  10. Transfer the mixture into the spin column using a pipette; centrifuge at 8000×g for 1 minute; remove the flow-through.
  11. Add 500ml of Buffer DW1 to the spin column; centrifuge at 9000×g for 30 seconds; remove the flow-through. (Note: this washes off unwanted proteins and DNA adsorbed by the column.)
  12. Add 700μl wash solution (contains absolute ethanol); remove the flow-through. (Note: This step removes the insoluble impurities.)
  13. Repeat the previous step.
  14. Centrifuge the empty spin column at 9000 rpm for 1 minute. (Note: this removes the left-over alcohol on the surfaces.)
  15. Add 30μL of elution buffer (it can also be substituted with ionized water or ddH2O ) onto the membrane of the column; centrifuge at 9000 rpm for 1 minute.
  16. The four types of plasmids are collected in 4 spin columns.

*Buffer S was added to enhance the DNA’s adherence to the spin column’s wall
**Buffer SP1 was added because RNase A triggers RNA degradation
***Resuspending help increase the surface area of contact between the pellets and the reagents
****Buffer SP2 help make the mixture homogenous without breaking target DNA strands (plasmids). As linear bacterial chromosomes (compared to circular plasmids) are more easily dissociated and adsorbed by proteins, they will also form precipitates but circular plasmids will not.
*****Buffer SP3 is a buffer with strong acidity that will separate the testing solution into two distinct sections: a turbid mix of complex proteins on the top and a clear solution of DNA on the bottom. Furthermore, its acidity neutralizes the solution and prevents alkali from causing DNA degradation.

7.2.1. Measure the concentration of four purified pUC57 plasmids (cagA/ipaH/invA/16S integrated plasmids)

Same procedure as “B. Test OD value of pET-28a integrated E. coli (dedicated to produce Cas12a protein)”, except set ddH2O as the controlled group.

Results of the test are shown in the table below:

Integrated Bacterial Sequence Data collected
ng/μl * A260/A280** A260/A230*** A260****
invA 270.5 1.93 2.16 5.411
16S 205.4 1.98 2.12 4.109
cagA 430.2 1.87 2.23 8.604
ipaH 333.7 1.94 2.13 6.674

* ng/μl: DNA concentration
** A260/A280: bacteria concentration
*** A260/A230: DNA purity, a value between 1.8 and 2.0 are considered as normal
**** A260: RNA residue, a value approximate to 2 is normal

7.2.2. PCR of four DNA fragments (cagA/ipaH/invA/16S)

Reagents: sgDNA (16), oligoDNA (8)
Purpose: PCR the sgRNA and prove that the target bacterial has been successfully transformed with the plasmid
  1. Three different sets of forward and reverse primers will be used to test the plasmid sample. With a total of four plasmid samples, twelve 200μl PCR tubes will be used. Different primers are depicted in the graph below:
    Number of Primer(s)
    Integrated
    sequence
    sgDNA(1)*
    forward
    sgDNA(1)
    reverse
    sgDNA(2)
    forward
    sgDNA(2)
    reverse
    oligoDNA**
    forward
    oligoDNA
    reverse
    16S T7-F 16S(-)1 T7-F 16S(-)2 16S-F 16S-R
    cagA T7-F cagA(-)1 T7-F cagA(-)2 cagA-F cagA-R
    invA T7-F invA(-)1 T7-F invA(-)2 invA-F invA-R
    ipaH T7-F ipaH(-)1 T7-F ipaH(-)2 ipaH-F ipaH-R

    *Two sets of sgDNAs will be used for each plasmid sequence. However, both will use the same forward primer. This is to compare and contrast the efficiency of primers of different lengths.
    **oligo DNA: forward and reverse primers start at the 5’ end of the upper and the lower strand of the integrated sequence. This set is to prove that the viral DNA has been integrated successfully into the plasmid.

  2. Aliquot the following reagents and cultures into each of the twelve PCR tubes in their assigned volumes using a pipette.
    Total Volume 120 μl
    2× concentrated MasterMix 60μl
    ddH2O 42μl
    Primer-forward 6μl
    Primer-reverse 6μl
    Template(plasmid) 6μl

    (2 possible candidates for sgRNA in the form of DNA and 1 oligoDNA for each of the four strands will undergo amplification)

  3. Place the PCR tubes into the thermocycler and run the PCR (lasting for approximately an hour)

7.2.3. Gel electrophoresis of DNA

Purpose:
1. Check if PCR results are successful (when compared with original strands and the marker)
2. Separation of pure sgRNA and oligo DNA strips

Goal: In this experiment, we run the PCR results of the two target DNAs (that will be reverse-transcribed into sgRNA), oligo DNA, and the original plasmid (before PCR, as a control group) for each of the 4 groups. There will be a total of 31 wells.
Equipment:
1. 4 patches of gel with a total of 31 wells
2. Each well has a capacity of 60μl

  1. Gel electrophoresis preparation (Agarose TAE gel solution preparation)
    1. Add 1g of agarose* powder and 100ml of TAE** into a conical flask using a spatula and a measuring cylinder
    2. Heat until agarose powder fully dissolves
    3. Until the solution cools down to room temperature, add 10μl nucleic acid dye into the mixture. The solution turns clear pink.
    4. Place the combs on the buffer dams
    5. Pour the Agarose-TAE solution onto the casting tray
    6. The gel is allowed to solidify, leaving a gel slab with a roll of wells on one end
    7. Place the solidified gel into a chamber filled with TAE buffer

    *agarose: agarose creates a sieve that separates DNA with nuance length differences
    **TAE: TAE buffer provides ions during the electrophoresis. We prepared the 300ml of the solution by adding the following reagents together in the following ratio: TAE: ddH2O = 1:50

  2. Using a pipette, add the following mixtures in their directed portions into the wells
    1. Target DNA (will be used as the template for sgRNA):
      1. Each bacterial strain (a total of 4 strains: cagA, 16S, invA, ipaH) will occupy 4 wells, two for sgRNA1 and two for sgRNA 2. A total of 16 (4*4) wells will be used. The reagents in the four wells are shown below:
        ii. sgRNA template 1a (55 μl)
        iii. sgRNA template 1b (55 μl)
        iv. sgRNA template 2a (55 μl)
        v. sgRNA template 2b (55 μl)

        *sgRNA 1a and 1b are obtained from the same tube. The same is for 2a and 2b.

      2. Add one marker (20μl) in the first well of each gel to help identify the length of the target sequence.
      3. Total wells: 3 markers + 4 * 4 = 19 wells
    2. oligo DNA:
      1. Arrangement of each bacteria sample (a total of 4: cagA, 16S, invA, ipaH) on gel: original plasmid (10μl) + PCR oligo DNA 1 (55μl) + PCR oligo DNA 2 (40 μl*)
      2. One marker (20μl) in the first well of each gel strip to help identify the length of target sequence
      3. Total wells: 1 + 4 * 3 = 13 wells
  3. Conduct electrophoresis
    1. Each side of the “electrophoresis tray” is connected to a pole (the red wire is connected to the positive pole, while the black wire is connected to the negative pole)
    2. Run electrophoresis at 400mA, 140V for 20 minutes
    3. Observe results under a UV light and compare sample strips to the marker during electrophoresis. It’s possible to identify different samples through their different positions in the tray.
  4. Recovery of DNA from gels
    Purpose: Recover target DNA for later use
    1. Put the gel under UV light* and cut off the light banded agar, and put the pieces into separate microcentrifuge tubes, each with one target sequence
    2. Add in a 1:3 ratio of buffer B2 solution to dissolve the agar (compare to mass)

      Agar Mass (g) and volume of Buffer B2 (μl) added

      Oligo DNA SgRNA 1 SgRNA 2
      cagA 0.30g: 900 μl 0.670g: 250 μl (Actual) 0.408g: 1200 μl
      16S 0.4078: 1200 μl 0.311g: 900 μl 0.767g: 2000 μl
      invA 0.306g: 900 μl 0.327g: 1000 μl 0.623g: 1850 μl
      ipaH 0.201g: 1000 μl 0.423g: 1360 μl 0.542g: 1600 μl
    3. After the gel dissolved, heat it at 55°C in a water bath for 5-8 minutes
    4. Centrifuge the gel solution for 30s at 8000×g, dispose of filtrate in the bottom of the tubes
    5. Add in 300 μl Buffer B2, centrifuge for 30s at 8000×g
    6. Remove unwanted solution in the bottom tube, add in 500 μl Wash solution, centrifuge for 30s at 9000×g, then remove unwanted solution in the bottom tube
    7. Repeat steps 6 and 7.
    8. Centrifuge again without adding any reagents for 60s at 9000×g
    9. Leave the centrifuge tubes in a ventilated area for 5 minutes to allow the evaporation of ethanol
    10. Add 27 μl Elution Buffer into the tubes, then centrifuge 60s at 9000×g
    11. The solution at the bottom of each tube is the recycled DNA
  5. Test DNA concentration
    Purpose: Check if the DNA concentration is suitable for later usage and that sufficient DNAs are recovered

    Same procedure as “B. Test OD value of pET-28a integrated E. coli (dedicated to producing Cas12a protein)”, except set Elution Buffer as the control group before testing the concentration

    The test results are shown in the table below:

    cagA 16S invA ipaH
    Oligo DNAs 38.65 108.1 64.95 4.9
    SgRNA 1 12.75 0.4 20.75 28.4
    SgRNA 2 11.3 17.7 17.84 15.8

7.3.1. DNA in vitro transcription

Purpose: Transcribe the target DNA into sgRNA that can be utilized as a guilder in the final system
Apparatus: pipette , micro-centrifuge tube (size 0.2ml), clean bench, thermal cycler, test tube rack
Reagents: T7 transcription kit, T7 RNA polymerase, RNase Free Water, 75% Ethanol

  1. Prepare two micro-centrifuge tubes with size 0.2ml and put them into a cask
  2. Transfuse 10μl of T7 Transcription Kit into each of the tubes
  3. Check the concentration (ng/μl) of the template obtained in 7.2.4. and calculate an appropriate volume of template in which the mass of sgRNA should be equal or greater than 50ng.
  4. After identifying the volume needed that satisfies the mass requirement of sgRNA, in a total volume of 9μl, the RNase-free water needed will be 9μl subtract the volume the of template. Depending on the volume of the template and RNase-free water needed, the one with greater volume needs to be transfused into the tubes first, and then the other one.
  5. Add 1μl of T7 RNA Polymerase to all tubes, creating a system of 20μl. (If there are any solution droplets adhering to the tube walls, apply a few seconds of centrifugation) The content in each of the test tubes is recorded in the chart below.
    Name of Reagent/Template SgRNA1 cagA SgRNA2 cagA SgRNA1 ipaH SgRNA2 ipaH SgRNA1 invA SgRNA2 invA SgRNA1 16S SgRNA2 16S
    T7 Transcription Kit added(μl) 10 10 10 10 10 10 10 10
    T7 RNA Polymerase added(μl) 1 1 1 1 1 1 1 1
    RNase Free Water added(μl) 4 4 3 3 3 3 9 3
    Template added(μl) 5 5 6 6 6 6 0 6
  6. Place all tubes into the thermal cycler at 37°C for 2 hours.
  7. After incubation, use Nanodrop to measure the concentration of the product RNA; set DNA in vitro transcription reagent* as the controlled group and record the results.

Results are shown in the graph below:

Test result/Template SgRNA1 cagA SgRNA2 cagA SgRNA1 ipaH SgRNA2 ipaH SgRNA1 invA SgRNA2 invA SgRNA1 16S SgRNA2 16S
Concentration (ng/ μl) 3197.0 2871.3 2702.2 3116.0 3169.0 2368.7 3696.1 2759.1
A260/A280 1.97 1.96 1.95 1.99 1.98 1.97 2.00 1.93
A260/A230 2.34 2.33 2.27 2.39 2.37 2.27 2.37 2.16

* DNA in vitro transcription reagent group:

  • T7 Transcription Kit (10μl)
  • T7 RNA Polymerase (1μl)
  • RNase Free Water (9μl)

7.3.2. sgRNA purification

  1. In a 2ml microtube, add 350 μL Buffer RLT* using a pipette
  2. Add 80μL sgRNA sample into the same microtube
  3. Add in 250μL AR, and anhydrous ethanol, mix gently while also preparing the RNeasy spin column, and transfer all solutions into the column
  4. Add 350 μL Buffer RW1 to the RNeasy spin column. Close the lid, and centrifuge for 15s of 8000 g. Discard the flow through.
  5. Add 500 μL Buffer RPE to the RNeasy spin column. Close the lid, and centrifuge for 15s of 12000 g. Discard the flow through.
  6. Add 500 μL Buffer RPE to the RNeasy spin column. Close the lid, and centrifuge for 2 min of 12000 g. Discard the flow through.
  7. Place the RNeasy spin column in a new 1.5ml collection tube. Add 30 μL RNase-free water directly to the spin column membrane. Close the lid, and centrifuge for 2 min of 8000g to elute the RNA.
  8. The flow through is the purified RNA.
  9. Test RNA concentration

    Same procedure as “B. Test OD value of pET-28a integrated E. coli (dedicated to produce Cas12a protein)”, except set ddH2O as the controlled group.

Test results:

ng/ μL A260/A280*
16S sgRNA 1 3.1 1.20
16S sgRNA 2 11.5 1.04
invA sgRNA 1 10.3 1.62
invA sgRNA 2 14.7 1.62
ipaH sgRNA 1 12.5 2.11
ipaH sgRNA 2 13.6 1.53
cagA sgRNA 1 461.5 1.04
cagA sgRNA 2 12.4 1.64

*A260/A280: a ratio near 1.60 depict a good result

Purpose: Reassemble Cas12a-sgRNA compound and test if the system can recognize the target sequences in the form of plasmids, oligo DNAs and bacterium after lysis.

8.1.1. Electrophoresis test

  1. Prepare oligoDNA groups:
    Materials needed:
    oligo DNA concentration /ng/μl oligo DNA volume/μl sgRNA volume/μl cas12a protein volume/μl reaction buffer volume/μl
    ipaH 4.9 20.4 5 3 21.6
    invA 64.95 1.54 5 3 40.46
    16S 0.925 0.925 5 3 41.075
    cagA 2.59 2.59 5 3 39.41

    *Note that the volume of oligo DNA varies according to its concentration. But each centrifuge tube should hold a total of 100M oligo DNA. The reaction buffer will also vary to achieve a fixed volume of 50 μl.

    1. In 8 separate 200μL centrifuge tube, add in sgRNA (cagA sgRNA1, cagA sgRNA2, ipaH sgRNA1, ipaH sgRNA2, invA sgRNA1, invA sgRNA2, 16S sgRNA1, 16S sgRNA2) cas12a protein and reaction buffer in the following volumes using a pipette in a clean bench.
    2. Centrifuge the mixture for 30s.
    3. Incubate the solution in a gradient thermal cycler at 37℃ for 10 minutes.
    4. In each centrifuge tube, add in the corresponding oligo DNA according to the volume recorded in the table above using a pipette.
    5. Centrifuge the systems briefly.
    6. In 4 separate centrifuge tubes, add in 50μl of ipaH, invA, cagA ,and 16S oligo DNA without incubation as the controlled group.
    7. Incubate all tubes in a gradient thermal cycler at 37℃ for 2 hours and then at 95℃ for 5 minutes to denature Cas12a proteins.
  2. Electrophoresis of all 8 oligo DNA tubes:
    1. Add 2μl 10×Loading Buffer to each 20μl Oligo DNA system
    2. Load 10μl 10× Buffer and Oligo DNA mixture into each well
    3. Load 10μl DNA marker in the well
    4. Run the gel at 80-150 V until the dye line is approximately 75-80% of the way down the gel. This will take about 20 minutes
    5. Open UV light to visualize DNA fragments

8.2.1. Using ssDNA (fluorescent) and multiscan ascent

  1. Prepare plasmids groups:
    Materials needed:
    plasmid vol/μL ssdna volume/μL sgRNA volume/μL cas12a protein volume/μL reaction buffer volume/μL
    ipaH 0.5 3 5 3 38.5
    invA 0.5 3 5 3 38.5
    16S 0.5 3 5 3 38.5
    cagA 0.5 3 5 3 38.5
    1. In 8 separate 200μL centrifuge tubes, add in sgRNA (cagA I, cagA II, ipaH I, ipaH II, invA I, invA II, 16S I , 16S II), cas12a protein and reaction buffer in the volumes depicted in the above chart using a pipette in a clean bench.
    2. Incubate the solution in a gradient thermal cycler at 37℃ for 10 minutes.
    3. In each centrifuge tube, add in the corresponding plasmids and ssDNA according to the volume recorded in the table above.
    4. Incubate the tubes in a gradient thermal cycler at 37℃ for 2 hours and then at 95℃ for 5 minutes to denature Cas12a proteins.
  2. Configure Negative Control Group of Cas12A-crRNA complex (without incubation):
    1. Add 38.5μl reaction buffer and 3μl of 50nM Cas12a to a microtube.
    2. Divide the reagent into 8 micro tubes of 5μl each (the excess will be used as a backup)
    3. 5μl of corresponding sgRNA (cagA sgRNA1, cagA sgRNA2, invA sgRNA1, invA sgRNA2, 16S sgRNA1, 16S sgRNA2, ipaH sgRNA1, ipaH sgRNA2) were added into each tube
    4. 0.5μl of corresponding plasmid and 3μl ssDNA fluorescent probe were added in every tube
  3. Measurement of ssDNA fluorescence value:
    1. Pipette 37 μl of solution from each of the tubes and controlled group* into the 96 wells light screen
    2. Measure fluorescence response of the bacteria culture using Multiskan Ascent

8.3.1. Test the efficacy of Cas12a-sgRNA system using electrophoresis:

  1. Bacteria lysis
    1. Using a pipette, transfer 1 ml of each of the four E. coli cultures(16S, cagA, ipaH, invA) into a centrifuge tube and centrifuge for 1 minute at 8000 rpm. Discard the supernatant.
    2. Add 50 μLllysis buffer into all four tubes.
    3. Place all tubes into a water bath and heat at 80℃ for 10 minutes
    4. Centrifuge all tubes again at 8000 rpm for 2 minutes
    5. Pipette at least 5 μl for each of the four E. coli colonies into at least two separate 20 μl microtubes. A total of 14 tubes of the bacterium are collected in this step.
    6. Extract 10 μl of each of the four E. coli inoculants into a microtube using a pipette and store them in a 4°C environment to use for electrophoresis in step 4.
  2. Incubation of Cas12a and sgRNA system and cleavage of target sequences
    1. A total of 16 1.5ml microtubes (1 tube for each sgRNA and the other as the controlled group) will be prepared each with 45μl of solution. Add all the following reagents and mediums using a pipette and on a clean bench.
      • Cas12a protein (3 μl)
      • 50/500ng sgRNA (5μl)
      • Reaction buffer (37 μl)
    2. Incubate in a gradient thermal cycler at 37℃ for 10 minutes.
    3. In all 14 microtubes, add in 5 μl of each of the four corresponding bacteria and label the tubes.
    4. Place one complete set of tubes with non-repetitive sgRNA sequences (8 tubes) in a gradient thermal cycler and PCR at 12000×g for 5 minutes.
    5. Centrifuge the tube at 8000×g, allowing the bacterium fully interact with the system.
    6. Incubate the product at 37℃ for 2 hours.
    7. Further heat the tubes at 95 °C for 5 minutes to halt all denature all Cas12a proteins and halt all protein activities.
  3. PCR
    1. Add 60 μl Mix Master Enzyme, 42 μl ddH2O, 12 μl Primer (6 μl Forward Primer and 6 μl Reverse Primer) and 6 μl incubated medium from step 2 into a centrifuge tube for each of the 14 tubes and run PCR in a gradient thermal cycler.
  4. Prepare electrophoresis
    1. Add in the following reagents using a pipette into a beaker and briefly heat it until all reagents fully dissolve
      • 2 g Agarose Regular
      • 100 ml TAE solution
      • 3 μl Nucleic Acid Gel Stain
    2. Add gel into the mould and wait until it solidifies.
    3. Add TAE buffer and gel into the electrophoresis machine
  5. Pipette 10 μl of 18 bacterial samples into each of the gel’s wells and run electrophoresis at 180V for 10 minutes.

8.3.2. Test the efficacy of the Cas12a-sgRNA system using ssDNA (fluorescent) and multiscan ascent

  1. Bacteria lysis
    1. Using a pipette, transfer 1 ml of each of the four E. coli cultures into two centrifuge tubes and centrifuge for 1 minute at 8000 rpm. Discard the supernatant.
    2. Add 50 μl lysis buffer into all four tubes.
    3. Place all tubes into a water bath and heat at 80℃ for 10 minutes
    4. Centrifuge all tubes again at 8000 rpm for 2 minutes
    5. Obtain 2 μl of the supernatant and pipette 4 μL for each of the two E. coli colonies into two separate 20 μl microtubes.
  2. Incubation of Cas12a and sgRNA system and target sequence cleavage
    1. A total of 16 1.5ml microtubes (2 tubes for each plasmid and 8 as controlled) will be prepared each with 50μl of solution. Add all the following reagents and mediums using a pipette and in a clean bench.
      • Cas12a protein (3 μl)
      • 50/500ng sgRNA (5μl)
      • Reaction buffer (34 μl)
    2. Incubate in a gradient thermal cycler at 37℃ for 10 minutes.
    3. To 8 of the 1.5 ml microtubes, add in 2 μl of the corresponding bacterium supernatant from step 1. Leave the other tubes bacteria-free.
    4. Incubate all tubes at 37℃ for 2 hours in a gradient thermal cycler.
    5. Further heat all tubes at 95℃ for 5 minutes to halt protein activities.
  3. Test using ssDNA and multiscan accent
    1. In a 96 well light screen, add 3 μl of fluorescent ssDNA and 2 μl of 3 ipaH E. coli plasmids (1 well for each of the two sgRNAs and 1 well without the plasmid as control), filling a total of 8 wells. In the four wells that are not the controlled group, add in Cas12a-sgRNA assay until the volume meets 50 μL.
    2. Test for fluorescent using the multiscan accent every 0.5 hours for the next 2 hours. Results are depicted in the table and graph below.

Primer sequence:

16S:

F: CCGTAAGGAGGAGGAAGGT
R: GCAACATGGCTGATTTGCG
FIP: TTGCTTCTCTTTTGTGCACCCCCAGTCAAGTCATCATGGCCCTT
RIP: ACTGCGAAGTGGGGAGCCAATCTTTGCTTCATGCAGGCAGTT

cagA:

F: GATTTAATCAACAAAGACGCTC
R: TCTGCTTTTTCTTTGTCATCAGG
FIP: CCAACTTGTGAAAATTCGGTAACGGTAGAATCTTCCACAAAGAGCT
RIP: GTGTCCCATCAAAACGATCCGTAGGGGGTTGTATGgTATgTTCC

invA:

F:GGCGATATTGGTGTTTATGGGG
R: AACGATAAACTGGACCACGG
FIP: GACGACTGGTACTGATCGATAGTTTTTCAACGTTTCCTGCGG
BIP: CCGGTGAAATTATCGCCACACAAAACCCACCGCCAGG

ipaH:

F:GCTTCGACAGCAGTCTTT
R: GGCCAGGTAGACTTCTATCT
FIP: CCTTCTGATGCCTGATGGACCCACTGAGAGCTGTGAGGA
BIP: ATAATGATACCGGCGCTCTGCCCTCCAGAATTTCGAGGC


Procedure:

  1. Unfreeze 2× Lamp Master mix and primer on ice and mix the two reagents thoroughly.
  2. Create the reaction system by adding the following reagents in their assigned portions into a microtube.
    Reagent 25μl Reaction system Final concentration
    2×Lamp Master Mix 12.5 μl 1×
    FIP (10μM) 2μl 0.8μM
    BIP (10μM) 2μl 0.8μM
    F3 (10μM) 0.5μl 0.2μM
    B3 (10μM) 0.5μl 0.2μM
    Template DNA 1.5μl 1-4 ng/μl
    DNA polymerase 0.5μl 0.16 U/μl
    Sterilized ddH2O 5.5μl -
  3. Place the microtube into a 65℃ water bath and heat it for 30-60 minutes.
  4. Place the tube in a gradient thermo cycler and heat at 80℃ for 10 minutes to denature all DNA polymerase.
  5. Test resulting DNA using gel electrophoresis:
    1. Prepare 1% gel electrophoresis by preparing the gel
    2. Pipette 3-5μl of LAMP resultant using a pipette and run gel electrophoresis at 180V for 10 minutes.
    3. Agarose electrophoresis was used for detection. Take 3-5μl amplification products, prepare 1% agar gel for electrophoresis detection, and lamp characteristic maps composed of different size bands can be seen.