Experiments

Strain and culture condition

All strains of bacteria and plasmids used in this project are listed in Table 1 and Table 2.

Table 1: Bacteria used for FitD and Zosteric acid experiments
Strains Characteristics Reference or source
E. coli DH5α Cloning strain Strain available in the lab
Pseudomonas protegens CHA0 Contains fitD, strain we used to overexpress the toxin Gift from Christoph Keel laboratory
E. coli BL21(DE3) Strain we used to produce ZA Strain available in the lab
E. coli DH5α cysPUWA-DNCQ Cloning strain with plasmid encoding for sulfate intake genes This project
E. coli DH5α cysP-DNCQ Cloning strain with plasmid encoding for sulfate intake genes This project
E. coli DH5α Tal-SULT1A1 Cloning strain with plasmid encoding for ZA production catalytic enzymes This project
E. coli DH5α SULT1A1-Tal Cloning strain with plasmid encoding for ZA production catalytic enzymes This project
E. coli BL21 (DE3) cysPUWA-DNCQ-T-S Expression strain with plasmids encoding for cysPUWA and Tal-SULT1A1 genes This project
E. coli BL21 (DE3) cysPUWA-DNCQ-S-T Expression strain with cysPUWA and SULT1A1-Tal genes This project
E. coli BL21 (DE3) cysP-DNCQ-S-T Testing strain with cysP and SULT1A1-Tal genes This project
Table 2: Plasmids used for FitD and Zosteric acid experiments
Plasmids Characteristics Reference or source
pSEVA2313 Plasmid with constitutive EM7 promoter, for insertion of fitD and fitG 1
pSEVA234 Plasmid with inducible trc-lac promoter, for insertion of fitD and fitG 1
pET17b Plasmid backbone for insertion of SULT1A1 and tal-fjo gene Novagen
pCOLADuet Plasmid backbone for insertion of cysP/PUWA and cysDNCQ genes Novagen
pETDuet Plasmid backbone for insertion of SULT1A1 and tal genes Gift from Stephan Gruber laboratory
Table 3: Genes used for FitD and Zosteric acid experiments
Gene or operon Purpose Reference or source
fit operon Contains a type 1 secretion system, fitD gene, outer membrane protein coding gene fitE and regulation genes fitF, fitG and fitH 2
fitD Toxin belonging to a virulence operon with insecticidal and molluscicidal agent 2
fitG Activator of fitD expression belonging to virulence operon 2
cysP Gene for sulfate intake 3
cysPUWA Gene for sulfate intake 3
cysDNC Gene for sulfate intake 3
cysQ Gene for sulfate intake 3
SULT1A1 Gene encoding for catalytic enzymes for the production of zosteric acid 3
tal-fjo Gene encoding for catalytic enzymes for the production of zosteric acid 3

Pseudomonas protegens and Escherichia coli strains were grown in liquid lysogeny broth (LB) medium at 35°C with 220 rpm shaking. Only for ZA production, E. coli BL21(DE3) strains were grown in M9 minimal media supplemented with 4 mM coumaric acid and 10 mM of sulfate (chemodex). For culture on solid medium, all strains were grown on LB agar plates (1.5% (w/v) agar). Ampicillin (100 µM) and kanamycin (50 µM) antibiotics were added to the medium, where appropriate.
Induction of gene expression was achieved by the addition of Isopropyl β-D-1-thiogalactopyranoside (IPTG) in liquid cultures to a final concentration of 0.1 mM; at mid-logarithmic growth phase for FitD expression and directly after culture inoculation for zosteric acid (ZA) production.
To preserve relevant strains, glycerol stocks were prepared by mixing overnight cultures with glycerol (to a final concentration of 20%) in a cryotube and stored at -80°C.

Preparation of electrocompetent strains

To make electrocompetent E. coli DH5α and E. coli BL21(DE3), we prepared a pre-culture and used it for inoculation of the main culture on the next day. The cells were grown overnight, then centrifuged and washed three times with H2O. The washed cells were then used to make glycerol stocks (10% v/v diluted in H2O) of competent cells.
To make electrocompetent P. protegens, we made an overnight culture of our bacteria at 35°C. Our cells were centrifuged and washed two times with 1mM MOPS buffer + 15 % glycerol for 5 minutes at 6000 rpm. The washed cells were then directly electroporated with our plasmids of interest as we were warned that we can’t make glycerol stocks of competent P. protegens cells.

Cloning

Polymerase Chain Reactions (PCRs) were performed to amplify genes of interest using Phanta polymerase master mix (Vazyme) and the primers listed in Table 4. PCR programs were set according to provider instructions. PCR products were analyzed by gel electrophoresis on 1% (w/v) agarose (solved in Tris-borate-EDTA (TBE)) containing SYBR Safe DNA dye (running condition: 110 V, 40 min). Once we were sure that the obtained DNA fragments had a correct length, PCR products were purified using ReliaPrep DNA Clean-up and Concentration system kit (Promega) according to the manufacturer's instructions. If necessary, DNA fragments were extracted from agarose gels using QIAquick Gel extraction kit (Qiagen) according to the manufacturer’s instructions.
To construct our plasmids from the different DNA fragments produced via PCR, we performed Gibson assembly using HiFi mastermix (NEBuilder) that contains 5’ exonuclease. The Gibson assembly reaction mixes were incubated at 50°C for one hour. Electrocompetent E. coli DH5α were transformed by electroporating 1 µL of Gibson assembly reaction mix into 50 µL of competent bacteria in a 2 mm electroporation cuvette at 2500 V (time constant was around 5 and 6 ms). After electroporation, 500µL of SOC medium were added and the liquid culture was then recovered at 35°C. After the incubation time, the liquid cultures were then plated on LB agar plates with the appropriate antibiotic and incubated at 35°C for 24 hours.
Colony PCR were performed using primers listed in Table 3 to screen for the correct plasmid constructs. Single bacterial colonies were picked from agar plates and resuspended in 100 µL of LB with the corresponding antibiotic. 1 µL of the resulting solution was mixed with 20 µL of water, 2 µL of forward and reverse primer (Table 3) and 25 µL of Taq polymerase master mix. Colony PCRs were performed using the standard PCR program adapted based on the annealing temperature of the primers and target fragment length (1 minute per 1000 base pairs).
Once the correct constructs were identified, the corresponding colonies were grown in liquid LB media supplemented with the appropriate antibiotic at 35°C for 16 hours and plasmids were extracted using PureYield Plasmid Miniprep System kit (Promega) according to the manufacturer’s instructions. All of the obtained plasmid constructs were verified by Sanger sequencing (Microsynth, Switzerland). For large constructs (e.g. plasmids containing fitD gene), Nanopore sequencing (Plasmidsaurus, USA) were used for verification instead. For overexpression of FitD protein, correct plasmids were electroporated into P. protegens CHA0 strain. For production of Zosteric acid, combinations of plasmids (Table 1) were electroporated into E. coli BL21(DE3) strain.

Sample preparation for mussel survivability assay

Starting cultures were prepared by growing P. protegens strains in liquid LB media (50 mL) supplemented with kanamycin and 0.1 mM IPTG (if induction is necessary) overnight. Optical density (OD) of these cultures were determined by measuring absorbance at 600 nm. Once the OD is assessed, we proceed to wash the cultures three times by centrifugation at 4’400 rpm for 10 minutes and resuspension in 25 mL of 1x PBS. Then, the samples were divided into two, for the lysed and non-lysed sample preparation. For the lysed sample preparation, cell suspensions were centrifuged at 4’400 rpm for 10 minutes to obtain cell pellets, and then these pellets were resuspended in 1 mL PBS. These concentrated cell suspensions were transferred into a 2 mL reaction tube, and glass beads (diameter 100 µm) were added into each sample to reach a final volume of 2 mL. The reaction tubes were then placed in the bead beating machine (FastPrep-24; MP Biomedicals) and a program of 8 cycles consisting of 30 seconds beating and 30 seconds cooling was applied. This experiment was performed inside a 5 °C cold room to ensure that the bead beating machine and the samples did not overheat. Light microscopy and serial dilutions were performed to assess the effectiveness of the cell lysis treatment (Figure 1). Approximately 98% of the cells were lysed after this treatment.

explanation of FitD
Figure 1: Cells A. before and B. after bead-beating treatment.

After cell lysis treatment, the concentrated cell suspensions (including the glass beads) were transferred into a 50 mL Falcon tube and resuspended to reach the initial volume, in our case 50 ml. This will restore the initial concentration of lysed cells. Lysed samples were diluted with lake water to reach the desired OD (OD 1, 0.5, 0.25, 0.125). Finally, 10 mL of these cell suspensions were added to Petri dishes containing each one mussel.

Keeping quagga mussels alive

Mussels were taken fresh from Lake Geneva prior to every experiment. The amount of mussels taken was dependent on our experimental design, on which we applied the 3R (Replace, Reduce, Refine) principle. If you are interested in the procedure that we used to keep mussels alive in our laboratory you can check our page “Contributions”

High Performance Liquid Chromatography

High performance liquid chromatography (HPLC) was performed to quantify the production of zosteric acid. In preparation for HPLC analysis, the overnight liquid cultures of E. coli BL21 (DE3) containing the zosteric acid production constructs and grown in M9 media were spun down for 10 min at 4’400rpm. The supernatant was collected and filtered to eliminate bacterial residues and sent for HPLC analysis. HPLC was performed at the EPFL facility with a HPLC Waters 1500 model using a C18 column (75mm x 4.6mm, particles of 3.5µm diameter) and the mobile phase consisted of MeOH 20% as solvent A and a tampon phosphate (pH=3 ; 0.0125M) as solvent B. Injection volume was 20 µL and flow rate was set to 0.8 ml/min. HPLC standard curves for the detection of zosteric acid and coumaric acid were prepared using pure samples obtained from Toronto Research Chemicals Inc and Chemodex, respectively.

Table 4: List of primers used for our experiments
Primers Sequence Purpose
D-D1/cPCR3 cacgcccaagtcctacatcag Colony PCR of fitD
D-2fr1 catggagcagcacctggtg Extract fitD from Pseudomonas protegens
D-2fr2 caccaggtgctgctccatg Extract fitD from Pseudomonas protegens
A1 accgagctcgaattcgcg Extract backbone from plasmid and do gibson assembly
A2 cgtcgtgactgggaaaaccc Extract backbone from plasmid and do gibson assembly
D-B1 cgcgaattcgagctcggtatggcttttatgtccaaggacttcac Extract fitD from Pseudomonas protegens
D-B2 gggttttcccagtcacgacgtcaggtcagtgaaggcaccag Extract fitD from Pseudomonas protegens
cPCR2 gtcagccagttcagacgcac Colony PCR of fitD and fitG
G-B1 cgcgaattcgagctcggtatgcctaacttcgcagatctgg Extract fitG from Pseudomonas protegens
G-B2 gggttttcccagtcacgacgctagcgggtgtcctgggtc Extract fitG from Pseudomonas protegens
G-cPCR1 cttggtgtccaaccggcaag Colony PCR of fitG
MM_P001 CTTTAATAAGGAGATATACCatggaattagccgctattttattta cysP gene amplification with overhang BB
MM_P002 tacgattcccccgccttg cysP gene amplification with overhang on interregion
MM_IR001 acaaggcgggggaatctgaTCGAACAGAAAGTAATCGTATTG Interregion amplification with overhang on cysP gene
MM_IR002 gtaagtcgtatttgatccatATGTATATCTCCTTCTTATACTTAACT Interregion amplification with overhang on cysD gene
MM_DNC001 atggatcaaatacgacttactca cysD gene amplification
MM_DNC002 tcaggatctgataatatcgttctg cysC gene amplification
MM_Q001 aacgatattatcagatcctgataacaccgctcacagagac cysQ gene amplification with overhang on BB
MM_Q002 TGCTCAGCGGTGGCAGCAGttagtaaatagacactctgaacccc cysQ gene amplification with overhang on cysC gene
FR_PUWAfwd_01 CTTTAATAAGGAGATATACCatggccgttaacttactgaaaaagaac cysPUWA gene amplification with overhang on BB
FR_BBrev_01 GGTATATCTCCTTATTAAAGTTAAACA BB amplification
FR_PUWARev_01 TACGATTACTTTCTGTTCGAtcaggcgctttgtgcgag cysPUWA gene amplification with overhang on interregion
FR_INTERfwd_001 TCGAACAGAAAGTAATCGTATTG Interregion amplification
FR_BBfwd_01 CTGCTGCCACCGCTG BB amplification
SD_001 ATGAACACCATCAACGAATATCTGAGC tal gene amplification
SD_002 tcaATTGTTAATCAGGTGGTCTTTTACTTTCTG tal gene amplification
SD_003 ATGGAATTCAGTCGCCCACCC SULT1A1 gene amplification
SD_004 TCAAAGCTCGCAGCGGAACTTG SULT1A1 gene amplification
SD_005 AGTTCCGCTGCGAGCTTTGAtaattaacctaggctgctgc Backbone amplification
SD_006 TATTCGTTGATGGTGTTCATggtatatctccttcttaaagttaaaca Backbone amplification
SD_007 ACCACCTGATTAACAATtgagcggccgcataatgcttaag Interregion amplification
SD_008 GGTGGGCGACTGAATTCCATatgtatatctccttcttatacttaact Interregion amplification
SD_009 ACCACCTGATTAACAATtgataattaacctaggctgctgc Backbone amplification
SD_010 GGTGGGCGACTGAATTCCATggtatatctccttcttaaagttaaaca Backbone amplification
SD_011 AGTTCCGCTGCGAGCTTTGAgcggccgcataatgcttaag Interregion amplification
SD_012 TATTCGTTGATGGTGTTCATatgtatatctccttcttatacttaact Interregion amplification
MM_SeqP01 CCCTGTAGAAATAATTTTGTTTAAC cysP gene sequencing 1st primer
MM_SeqP02 GCCGTGTACAATACGATTAC cysP gene sequencing 2nd prime
MM_SeqDNCQ01 TCCCCATCTTAGTATATTAGTTAAG cysDNCQ gene seqencing 1st primer
MM_SeqDNCQ02 CAAATGCCTGAGGTTTCA cysDNCQ gene seqencing 2nd primer
MM_SeqDNCQ03 tgattgaccgcgaccaggcg cysDNCQ gene sequencing 3rd primer
MM_SeqDNCQ04 atgagatcgacatcagccgt cysDNCQ gene sequencing 4th primer
MM_SeqDNCQ05 gcagaaattcatctcaatgg cysDNCQ gene sequencing 5th primer
FR_seqPUWAfwd_001 ctggctctatagcccgcagg cysPUWA gene sequencing 1st primer
FR_seqPUWAfwd_002 ccggaaatatcgcgtggaagac cysPUWA gene sequencing 2nd primer
FR_seqPUWAfwd_003 aaccctgtcgctgccgttac cysPUWA gene sequencing 3d primer
FR_seqPUWAfwd_004 cgcgaaccggcgacccg cysPUWA gene sequencing 4th primer
SD_013 ttgtacacggccgcataatc tal gene sequencing 1st primer
SD_014 cccattcgccaatccggatatag tal gene sequencing 2nd primer
SD_015 ggatcgagatcgatctcgatcccg tal gene sequencing 3rd primer
SD_016 atttcgattatgcggccgtgtaca tal gene sequencing 4th primer
SD_017 ttgtacacggccgcataatc SULT1A1 gene sequencing

References

  1. Silva-Rocha, R., Martínez-García, E., Calles, B., Chavarría, M., Arce-Rodríguez, A., de las Heras, A., … de Lorenzo, V. (2012). The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research, 41(D1), D666–D675. https://doi.org/10.1093/nar/gks1119
  2. Péchy-Tarr, M., Borel, N., Kupferschmied, P., Turner, V., Binggeli, O., Radovanovic, D., … Keel, C. (2013). Control and host-dependent activation of insect toxin expression in a root-associated biocontrol pseudomonad. Environmental Microbiology, 15(3), 736–750. https://doi.org/10.1111/1462-2920.12050
  3. Jendresen, C.B. and Nielsen, A.T. (2019). Production of zosteric acid and other sulfated phenolic biochemicals in microbial cell factories. Nature Communications, 10(1). doi:10.1038/s41467-019-12022-x.