Cellulopolis is centered around the engineering of Komagataiebacter rhaeticus AF1 towards the regulatable expression of bacterial cellulose for biomedical applications.
KrAF1 had not been previously engineered, thus we had to establish novel protocols for cultivation and transformation by electroporation, as well as design and construct new compatible plasmid backbones, basic parts, and composite parts.
All parts were constructed for compatibility with GoldenGate cloning with BsaI (from level 0 to level 1) or SapI (from level 1 to level 2). To the best of our knowledge, parts were registered in the parts registry, however, we are having difficulties editing the entries. As first-time iGEM participants, we hope that the judges find the entry mode acceptable.
To allow the development of the present project, we used the following iGEM parts supplied with the distribution kit:
| Part name | Part type | Backbone | Level | Source | Plate position | antibiotic selection marker |
|---|---|---|---|---|---|---|
| BBa_J04452 | backbone | pSB1C30 | 0 | iGEM kit plate 1 | 1O | chloramphenicol |
| BBa_J428346 | backbone | BBa_J428326 | 1A | iGEM kit plate 1 | 2K | kanamycin |
| BBa_J428347 | backbone | BBa_J428326 | 1A | iGEM kit plate 1 | 2M | kanamycin |
| BBa_J428347 | backbone | BBa_J428326 | 1A | iGEM kit plate 1 | 4A | kanamycin |
| BBa_J428366 | backbone | BBa_J428327 | 2 | iGEM kit plate 1 | 6K | spectinomycin |
| BBa_J428367 | backbone | BBa_J428327 | 2 | iGEM kit plate 1 | 6M | spectinomycin |
| BBa_J428369 | backbone | BBa_J428327 | 2 | iGEM kit plate 1 | 8A | spectinomycin |
| BBa_J428342 | backbone | BBa_J428326 | 1B | iGEM kit plate 1 | 2C | kanamycin |
| BBa_J428343 | backbone | BBa_J428326 | 1C | iGEM kit plate 1 | 2E | kanamycin |
| BBa_J428344 | backbone | BBa_J428326 | 1D | iGEM kit plate 1 | 2G | kanamycin |
| BBa_J23104 | promotor | pSB1C3SA | 0 | iGEM kit plate 1 | 9P | chloramphenicol |
| BBa_J23101 | promotor | pSB1C3SA | 0 | iGEM kit plate 1 | 16G | chloramphenicol |
| BBa_J23110 | promotor | pSB1C5SA | 0 | iGEM kit plate 1 | 13G | chloramphenicol |
| BBa_K2406216 | RBS | pSB1C5SB | 0 | iGEM kit plate 1 | 15A | chloramphenicol |
| BBa_J428092 | terminator | pSB1C5SD | 0 | iGEM kit plate 1 | 15I | chloramphenicol |
| BBF10K_003335 | CDS | pOpen_build | 0 | Open reporters free genes | A1 | ampicillin |
| BBF10K_003349 | CDS | pOpen_build | 0 | Open reporters free genes | A2 | ampicillin |
| BBF10K_003360 | CDS | pOpen_build | 0 | Open reporters free genes | C3 | ampicillin |
| BBF10K_003344 | CDS | pOpen_build | 0 | Open reporters free genes | D1 | ampicillin |
| BBF10K_003362 | CDS | pOpen_build | 0 | Open reporters free genes | E3 | ampicillin |
| BBF10K_000210 | CDS | pOpen_build | 0 | iGEM kit plate 2 | FLP (E6 pl2) | kanamycin |
| BBa_J428385 | AmpR | BBa_J428327 | iGEM kit plate 1 | 10G | ampicillin | |
| BBa_J428357 | CmR | BBa_J428326 | iGEM kit plate 1 | 12A | chloramphenicol | |
| BBa_J428381 | backbone | Loop pOdd-1 vector based on pJUMP26. Origin p15A (medium copy number) | 0 | iGEM kit plate 1 | 10i | kanamycin |
| BBa_J428382 | backbone | Loop pOdd-2 vector based on pJUMP26. Origin p15A (medium copy number) | 0 | iGEM kit plate 1 | 10k | kanamycin |
| BBa_J428383 | backbone | Loop pOdd-3 vector based on pJUMP26. Origin p15A (medium copy number) | 0 | iGEM kit plate 1 | 10m | kanamycin |
| BBa_J428384 | backbone | Loop pOdd-4 vector based on pJUMP26. Origin p15A (medium copy number) | 0 | iGEM kit plate 1 | 10o | kanamycin |
| BBa_J23107 | Regulatory | pSB1C3SA | iGEM kit plate 1 | 16C | chloramphenicol | |
| BBa_J23101 | Regulatory | pSB1C3SA | iGEM kit plate 1 | 16G | chloramphenicol | |
| BBa_J428039 | RBS | pSB1C3SB | iGEM kit plate 1 | 16E | chloramphenicol | |
| BBa_Z0262 | RBS | pSB1C3SB | iGEM kit plate 1 | 16O | chloramphenicol | |
| BBa_K3039002 | Coding | pSB1C3C | iGEM kit plate 1 | 18M | chloramphenicol | |
| BBa_J428067 | Coding | pSB1C3C | iGEM kit plate 1 | 18O | chloramphenicol | |
| BBa_J428069 | Terminator | pSB1C3SD | iGEM kit plate 1 | 18C | chloramphenicol | |
| BBa_J428089 | Terminator | pSB1C3SD | iGEM kit plate 1 | 20C | chloramphenicol |
According to multiple scientific papers, standard E. coli compatible replication origins are not functional in Komagataeibacter. Unusual chassis frequently require plasmids with broad species origins such as RK2, pBBR1 or RSF1010 (present in iGEM plasmids BBa_J428346, BBa_J428347, BBa_J428349, BBa_J428366, BBa_J428367 and BBa_J428369). Plasmids BBa_J428346, BBa_J428347, BBa_J428349 also encode the KanR marker and whereas BBa_J428366, BBa_J428367 and BBa_J428369 encode SpecR (the latter of which has not been proven effective in Komagataeibacter). Hence, the level 2 vectors supplied with the distribution kit were not compatible with our chassis. To overcome this, we designed primers JUMP_mF and JUMP_mR to amplify BBa_J428346, BBa_J428347, BBa_J428349, BBa_J428366, BBa_J428367 and BBa_J428369 excluding the KanR and SpecR selection markers. In parallel, we designed primers AmpR_F and AmpR_R to amplify the Ampicillin resistance cassette from BBa_J428385 and primers CmR_F and CmR_R to amplify the chloramphenicol resistance cassette from BBa_J428357.
Primers used for the construction of new backbones:
| Primer name | Sequence |
|---|---|
| JUMP-mR | GCTCTTCAGACTAGAGCGAAGTCTTCG |
| JUMP-mF | GCTCTTCTCCTTTTCCGCTGCATAACC |
| AdapterTU_reD_F | GGTCTCTGGAGGCTCTTCGATGCAATACGCAAACCGCCTCTC |
| AdapterTU_reD_R | GGTCTCTCATTGCTCTTCGACCTATAAACGCAGAAAGGCCCACC |
| AmpR_F | GCTCTTCTCCTATTTAAATTAGTAGCCCGCCTAATGAG |
| AmpR_R | GCTCTTCAGACGACAAGGGTCGTCCAAAAAAAAAGG |
| CmR_F | GCTCTTCTCCTATTTAAATAACAAACGGGATTGACTTTTAAAAAAGG |
| CmR_R | GCTCTTCAGACGACCGAAGTCCCTTCAAACTTC |
PCR products were purified and the backbone and the new antibiotic resistance marker with combined by GoldenGate assembly with SapI and T4 DNA ligase. Competent DH5alpha were transformed with the ligation products and transformants selected on LBamp supplemented with either ampicillin or chloramphenicol. Successful assemblies yielded plasmids encoding green fluorescence and either AmpR (BBa_K4435301 to BBa_K4435305) or CmR (BBa_K4435308 to BBa_K4435312).
Figure 2. Transformed E. coli testifying successful assemblies encoding AmpR (BBa_K4435301 to BBa_K4435305) or CmR (BBa_K4435308 to BBa_K4435312).
Our design of level 2 assembly of 4 transcriptional units requires the presence of SapI restriction with ends complementary to 5´of TU1 (pOdd1) and 3´of TU4 (pOdd4), thus we designed primers AdapterTU_reD_F and AdapterTU_reD_R and amplified the red reporter from BBa_J04452. PCR products were assembled by GoldenGate using BsaI and T4 DNA ligase with level 2 plasmids. Successful assembly yielded red colonies and original unedited plasmids yielded green colonies.
Komagataeibacter's new backbones (Type IIs compatible):
| New backbones | Details | Internal Code | Validation |
|---|---|---|---|
| BBa_K4435301 | amplification of BBa_J428346 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 2K to AmpR | phenotype |
| BBa_K4435302 | amplification of BBa_J428347 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 2M to AmpR | phenotype |
| BBa_K4435303 | amplification of BBa_J428349 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 4A to AmpR | |
| BBa_K4435304 | amplification of BBa_J428366 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 6K to AmpR | phenotype |
| BBa_K4435305 | amplification of BBa_J428367 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 6M to AmpR | phenotype |
| BBa_K4435308 | amplification of BBa_J428346 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 2K to CmR | |
| BBa_K4435309 | amplification of BBa_J428347 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 2M to CmR | phenotype |
| BBa_K4435310 | amplification of BBa_J428349 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 4A to CmR | |
| BBa_K4435311 | amplification of BBa_J428366 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 6K to CmR | phenotype |
| BBa_K4435312 | amplification of BBa_J428367 with JUMP_mF and JUMP_mF; amplification of antibiotic resistance marker; Golden gate cloning with SapI | 6M to CmR | |
| BBa_K4435315 | add ODD 4 TUs adapter, derived from BBa_J428366: pJUMP42x-2A SpecR Type IIS Level 2 vector. Origin RK2 (broad-host-range); | 6K_red | phenotype |
| BBa_K4435316 | add ODD 4 TUs adapter, derived from BBa_J428367: pJUMP43-2A SpecR Type IIS Level 2 vector. Origin pBBR1 (medium-copy, broad-host-range) | 6M_red | phenotype |
| BBa_K4435317 | add ODD 4 TUs adapter, derived from BBa_J428369: pJUMP45-2A SpecR Type IIS Level 2 vector. Origin RSF1010 (Broad-host-range) | 8A_red | phenotype |
| BBa_K4435306 | add ODD 4 TUs adapter to BBa_K4435304 | 6K to AmpR_red | phenotype |
| BBa_K4435307 | add ODD 4 TUs adapter to BBa_K4435305 | 6M to AmpR_red | phenotype |
| BBa_K4435313 | add ODD 4 TUs adapter to BBa_K4435311 | 6K to CmR_red | phenotype |
| BBa_K4435314 | add ODD 4 TUs adapter to BBa_K4435312 | 6M to CmR_red |
In addition to the novel backbones we also constructed a range of novel basic parts. The highlight of this collection are gene encoding the light-sensitive transcriptional repressor LexRO (BBa_K4435001) and its associated operon (BBa_K4435016). Unfortunately, these customs parts synthesized by IDT arrived just less than 3 weeks prior to the wiki freeze, which did not allow us time to evaluate their activity in Komagataeibacter. We amplified 1 kb genomic DNA fragments from K. rhaeticus and K. medellinensis that will flank our constructs directing their integration into the bacteria genome directly upstream of either bcsZ or bcsA. We also cloned a series of promotors, RBS, terminator and genes encoding key enzymes in the BC synthesis pathway to allow their overexpression and consequently redirect the metabolic flux towards BC production. Most basic parts have been cloned into pSB1C3 plasmids and await confirmation by sequencing.
New basic parts (constructed; awaiting sequencing results):
| New basic parts | Part type | Backbone | Internal Code | Source |
|---|---|---|---|---|
| BBa_K4435001 | Coding | pSB1C3C | LexRO | Gene synthesis |
| BBa_K4435002 | Coding | pSB1C3C | FLPe | Gene synthesis |
| BBa_K4435003 | Coding | pSB1C3C | dgc1 | Gene synthesis |
| BBa_K4435004 | Coding | pSB1C3C | Kr_galU PCR | K. rhaeticus AF1 gDNA |
| BBa_K4435005 | Coding | pSB1C3C | Kr_pgm PCR | K. rhaeticus AF1 gDNA |
| BBa_K4435006 | Coding | pSB1C3C | Kr_ndp PCR | K. rhaeticus AF1 gDNA |
| BBa_K4435007 | Coding | pSB1C3C | Kr_GK PCR | K. rhaeticus AF1 gDNA |
| BBa_K4435008 | Coding | pSB1C3C | Km_galU PCR | K. medellinensis gDNA |
| BBa_K4435009 | Coding | pSB1C3C | Km_pgm PCR | K. medellinensis gDNA |
| BBa_K4435010 | Coding | pSB1C3C | Km_ndp PCR | K. medellinensis gDNA |
| BBa_K4435011 | Coding | pSB1C3C | Km_GK PCR | K. medellinensis gDNA |
| BBa_K4435012 | promotor | pSB1C3SA | TUp_a | Gene synthesis |
| BBa_K4435013 | promotor | pSB1C3SA | TUp_b | Gene synthesis |
| BBa_K4435014 | promotor | pSB1C3SA | TUp_c | Gene synthesis |
| BBa_K4435015 | RBS | pSB1C3SB | TU_RBS | Gene synthesis |
| BBa_K4435016 | promotor with RBS | TU4p_RBS | Gene synthesis | |
| BBa_K4435017 | terminator | pSB1C3SD | TU_term | Gene synthesis |
| BBa_K4435020 | TU (homology arm) | pSB1C3C | TU4a_CDS_Kr | K. rhaeticus AF1 gDNA |
| BBa_K4435021 | TU (homology arm) | pSB1C3C | TU4b_CDS_Kr | K. rhaeticus AF1 gDNA |
| BBa_K4435023 | TU (homology arm) | pSB1C3C | TU4a_CDS_Km | K. medellinensis gDNA |
| BBa_K4435024 | TU (homology arm) | pSB1C3C | TU4b_CDS_Km | K. medellinensis gDNA |
| BBa_K4435022 | Coding | BBF10K_000210 | FLP | subcloning |
| BBa_K4435026 | Coding | pSB1C3C | gfasPurple | subcloning |
| BBa_K4435101 | TU (homology arm) | BBa_J428381 | TU1a_Kr | K. rhaeticus AF1 gDNA |
| BBa_K4435102 | TU (homology arm) | BBa_J428381 | TU1b_Kr | K. rhaeticus AF1 gDNA |
| BBa_K4435103 | TU (homology arm) | BBa_J428381 | TU1a_Km | K. medellinensis gDNA |
| BBa_K4435104 | TU (homology arm) | BBa_J428381 | TU1b_Km | K. medellinensis gDNA |
| BBa_K4435107 | TU (AmpR+FRT) | BBa_J428382 | TU2a | AmpR+FRT |
Level 1 and Level 2 composite parts thus combine elements for genomic integration of the LexRO system to control the bcs operon, or combine genes expressing oher key enzymes in the BC synthesis pathway aiming to enhance BC production.
Level 1 composite parts (design stage for most):
| Composite parts level 1 | Backbone | Promotor | RBS | CDS | Internal code | Description |
|---|---|---|---|---|---|---|
| BBa_K4435105 | BBa_J428381 | BBa_K4435012 | BBa_K4435015 | BBa_K4435022 | TU1_FLP | |
| BBa_K4435106 | BBa_J428381 | BBa_K4435012 | BBa_K4435015 | BBa_K4435002 | TU1_FLPe | |
| BBa_K4435129 | BBa_J428383 | BBa_K4435012 | BBa_K4435020 | BBa_K4435001 | TU3a | strong promotor controling the expression of the light sensitive transcriptional repressor LexRO |
| BBa_K4435130 | BBa_J428383 | BBa_K4435013 | BBa_K4435020 | BBa_K4435001 | TU3b | medium-strenght promotor controling the expression of the light sensitive transcriptional repressor LexRO |
| BBa_K4435131 | BBa_J428383 | BBa_K4435014 | BBa_K4435020 | BBa_K4435001 | TU3c | weak promotor controling the expression of the light sensitive transcriptional repressor LexRO |
| BBa_K4435111 | BBa_J428384 | BBa_K4435016 | BBa_K4435020 | TU4a_Kr | sequence corresponding to promotor, LexRO binding site and RBS upstream of bcs operon; 3´ portion of the construct includes 1 kb homology to Komagataribacter rhaeticus AF1, starting at ATG from bcsZ | |
| BBa_K4435112 | BBa_J428384 | BBa_K4435016 | BBa_K4435021 | TU4b_Kr | sequence corresponding to promotor, LexRO binding site and RBS upstream of bcs operon; 3´ portion of the construct includes 1 kb homology to Komagataribacter rhaeticus, starting at ATG from bcsA | |
| BBa_K4435113 | BBa_J428384 | BBa_K4435016 | BBa_K4435023 | TU4a_FKm | sequence corresponding to promotor, LexRO binding site and RBS upstream of bcs operon; 3´ portion of the construct includes 1 kb homology to Komagataribacter medellinensis, starting at ATG from bcsZ | |
| BBa_K4435114 | BBa_J428384 | BBa_K4435016 | BBa_K4435024 | TU4b_Km | sequence corresponding to promotor, LexRO binding site and RBS upstream of bcs operon; 3´ portion of the construct includes 1 kb homology to Komagataribacter medellinensis, starting at ATG from bcsA | |
| BBa_K4435115 | BBa_J428384 | BBa_K4435016 | BBa_K4435025 | TU4_lex_purple | lex operator controlling expression of purple reporter | |
| BBa_K4435120 | BBa_J428381 | BBa_K4435012 | BBa_K4435015 | BBa_K4435004 | Kr_galU_TU1 | K. rhaeticus AF1 galU_UTP-glucose-1-phosphate uridylyltransferase |
| BBa_K4435121 | BBa_J428382 | BBa_K4435012 | BBa_K4435015 | BBa_K4435005 | Kr_pgm_TU2 | K. rhaeticus AF1 pgm_Phosphoglucomutase |
| BBa_K4435122 | BBa_J428383 | BBa_K4435012 | BBa_K4435015 | BBa_K4435006 | Kr_ndp_TU3 | K. rhaeticus AF1 ndp_Nucleoside diphosphate pyrophosphorylase |
| BBa_K4435123 | BBa_J428384 | BBa_K4435012 | BBa_K4435015 | BBa_K4435007 | Kr_GK_TU4 | K. rhaeticus AF1 GK_Glucokinase |
| BBa_K4435124 | BBa_J428381 | BBa_K4435012 | BBa_K4435015 | BBa_K4435008 | Km_galU_TU1 | K. medellinensis galU_UTP-glucose-1-phosphate uridylyltransferase |
| BBa_K4435125 | BBa_J428382 | BBa_K4435012 | BBa_K4435015 | BBa_K4435009 | Km_pgm_TU2 | K. medellinensis pgm_Phosphoglucomutase |
| BBa_K4435126 | BBa_J428383 | BBa_K4435012 | BBa_K4435015 | BBa_K4435010 | Km_ndp_TU3 | K. medellinensis ndp_Nucleoside diphosphate pyrophosphorylase |
| BBa_K4435127 | BBa_J428384 | BBa_K4435012 | BBa_K4435015 | BBa_K4435011 | Km_GK_TU4 | K. medellinensis GK_Glucokinase |
| BBa_K4435128 | BBa_J428384 | BBa_K4435012 | BBa_K4435015 | BBa_K4435003 | dgc1_TU4 | dgc1_diguanylate cyclase |
Composite parts level 2 (design stage):
| Composite parts level 2 | Backbone | TU1 | TU2 | TU3 | TU4 | Internal code |
|---|---|---|---|---|---|---|
| BBa_K4435201 | BBa_K4435313 | BBa_K4435105 | BBa_K4435107 | BBa_K4435129 | BBa_K4435115 | FLP+Lex+Reporter |
| BBa_K4435202 | BBa_K4435313 | BBa_K4435106 | BBa_K4435107 | BBa_K4435129 | BBa_K4435115 | FLPe+Lex_strong+Reporter |
| BBa_K4435203 | BBa_K4435313 | BBa_K4435106 | BBa_K4435107 | BBa_K4435130 | BBa_K4435115 | FLPe+Lex_mid+Reporter |
| BBa_K4435204 | BBa_K4435313 | BBa_K4435106 | BBa_K4435107 | BBa_K4435131 | BBa_K4435115 | FLPe+Lex_weak+Reporter |
| BBa_K4435205 | BBa_K4435313 | BBa_K4435101 | BBa_K4435107 | BBa_K4435129 | BBa_K4435111 | upstream_complete_Kr |
| BBa_K4435206 | BBa_K4435313 | BBa_K4435102 | BBa_K4435107 | BBa_K4435129 | BBa_K4435112 | mid_complete_Kr |
| BBa_K4435207 | BBa_K4435313 | BBa_K4435103 | BBa_K4435107 | BBa_K4435129 | BBa_K4435113 | upstream_complete_Km |
| BBa_K4435208 | BBa_K4435313 | BBa_K4435104 | BBa_K4435107 | BBa_K4435129 | BBa_K4435114 | mid_complete_Km |
| BBa_K4435213 | BBa_K4435314 | BBa_K4435101 | BBa_K4435107 | BBa_K4435129 | BBa_K4435111 | upstream_complete_Kr |
| BBa_K4435214 | BBa_K4435314 | BBa_K4435102 | BBa_K4435107 | BBa_K4435129 | BBa_K4435112 | mid_complete_Kr |
| BBa_K4435215 | BBa_K4435314 | BBa_K4435103 | BBa_K4435107 | BBa_K4435129 | BBa_K4435113 | upstream_complete_Km |
| BBa_K4435216 | BBa_K4435314 | BBa_K4435104 | BBa_K4435107 | BBa_K4435129 | BBa_K4435114 | mid_complete_Km |
| BBa_K4435217 | BBa_K4435313 | BBa_K4435120 | BBa_K4435121 | BBa_K4435122 | BBa_K4435123 | Kr_all4 |
| BBa_K4435218 | BBa_K4435313 | BBa_K4435124 | BBa_K4435125 | BBa_K4435126 | BBa_K4435127 | Km_all4 |
| BBa_K4435219 | BBa_K4435313 | BBa_K4435120 | BBa_K4435121 | BBa_K4435122 | BBa_K4435128 | Kr_dgc1 |
| BBa_K4435220 | BBa_K4435313 | BBa_K4435124 | BBa_K4435125 | BBa_K4435126 | BBa_K4435128 | Km_dgc1 |
BBa_K4435001 is the codon optimised coding region for the transcriptional repressor LexRO. LexRO is a protein that, under dark conditions, forms dimers and bind to the lex operator in the promotor region of target genes, inhibiting transcription (Li et al., 2020).
| Original part | Limitation | Solution | New backbone | Status |
|---|---|---|---|---|
| BBa_J428346 | Need more markers to transform with different level 1 plasmids | engineer plasmid for AmpR | BBa_K4435301 | Design |
| BBa_J428347 | Need more markers to transform with different level 1 plasmids | engineer plasmid for AmpR | BBa_K4435302 | Design |
| BBa_J428349 | Need more markers to transform with different level 1 plasmids | engineer plasmid for AmpR | BBa_K4435303 | Design |
| BBa_J428366 | SpecR not tested in Komagataeibacter | engineer plasmid for AmpR | BBa_K4435304 | Design |
| BBa_J428367 | SpecR not tested in Komagataeibacter | engineer plasmid for AmpR | BBa_K4435305 | Transformed successfully in Komagataeibacter rhaeticus AF1 |
| BBa_J428369 | SpecR not tested in Komagataeibacter | engineer plasmid for AmpR | planning stage | |
| BBa_J428346 | Need more markers to transform with different level 1 plasmids | engineer plasmid for CmR | BBa_K4435308 | Design |
| BBa_J428347 | Need more markers to transform with different level 1 plasmids | engineer plasmid for CmR | BBa_K4435309 | Design |
| BBa_J428349 | Need more markers to transform with different level 1 plasmids | engineer plasmid for CmR | BBa_K4435310 | Design |
| BBa_J428366 | SpecR not tested in Komagataeibacter | engineer plasmid for CmR | BBa_K4435311 | Design |
| BBa_J428367 | SpecR not tested in Komagataeibacter | engineer plasmid for CmR | BBa_K4435312 | Design |
| BBa_J428369 | SpecR not tested in Komagataeibacter | engineer plasmid for CmR | planning stage | |
| BBa_J428366 | MCS not compatible | BBa_K4435315 | Design | |
| BBa_J428367 | MCS not compatible | BBa_K4435316 | Design | |
| BBa_J428369 | MCS not compatible | BBa_K4435317 | Design | |
| BBa_K4435304 | MCS not compatible | BBa_K4435306 | 2 optimization rounds | |
| BBa_K4435305 | MCS not compatible | BBa_K4435307 | 2 optimization rounds | |
| BBa_K4435311 | MCS not compatible | BBa_K4435313 | planing stage | |
| BBa_K4435312 | MCS not compatible | BBa_K4435314 | 2 optimization rounds |