Here we present our wetlab results in four sections: TCS1 Affi-PmrB/A system, TCS2 Affi-NisK/R system, logic gate, and reporter system.

Affi-PmrB/A System

Structure Prediction

In order to determine the feasibility of our modification, we first used AlphaFold2 software to predict the structure of the receptor Affi-PmrB that we constructed. Compared with the original receptor PmrB (uniport ID: P36557 · BASS_SALTY), the predicted structure of Affi-PmrB according to our modified sequences are highly similar. Almost identical structure is displayed in the recognition area of the receptor and ligand, confirming the feasibility of our modification.

Fig 1. (A)The predicted structure of Affi-PmrB by AlphaFold2. (B) The structure of PmrB.

Molecular docking was simulated between the modified receptor Affi-PmrB and the Fc peptide of IgG antibody to further determine the feasibility of our modification scheme. We downloaded the Fc peptide structure (PDB DOI: 10.2210/pdb5VGP/pdb) from the PDB database, and then used the online protein molecular docking software Vasklab. Simulation results demonstrated that the Fc peptide could still bind to the ligand recognition region of our modified receptor with hydrophobic bonds, indicating that our modification did not affect the binding of Fc peptide with affibody.

Fig 2. Molecular docking simulation results. (A) The predicted structure of Affi-PmrB. (B) The Fc region of IgG. (C) The simulation of molecular docking between Fc region and Affi-PmrB predicted by Vasklab.

In summary, the strutural prediction and molecular docking simulation results have verified the feasibility of our modification design, confirming that the modified receptor Affi-Pmr still possesses the correct structure capable of binding and interactering with the Fc region of IgG antibody. Therefore, we have demonstrated that theoretically our modified receptor Affi-Pmr can serve as a protein signal detector.

Plasmid Construction

This section presents the success of our plasmid construction. The cloning strategies and construction results for each plasmid are shown as follows. Detailed protocols can be found on the Method page.

pAffi-PmrB/A

Plasmid Design

pAffi-PmrB/A has the backbone of pET28a, carrying:

designed sequence to express Affi-PmrB
gene sequence to express PmrA
IPTG-inducible promoter, driving the expression of Affi-PmrB and PmrA
promoter PmrC, driving the expression of downstream reporter gene
EGFP as the reporter gene
resistance marker KanR for selection

Fig 3. Plasmid design of pAffi-PmrB/A.

Cloning Strategies

PCR with high fidelity Q5 polymerase was conducted to amplify fragments and linearize vectors. Fragments and linearized vectors were assembled by NEBuilder® HiFi DNA assesmbly.

Construction Results

Affi-PmrB-PmrA
PmrC
EGFP

Construction result of pAffi-PmrB/A.

Fig 4. Construction result of pAffi-PmrB/A.

pAffi-PmrB/A-amplifier

Plasmid Design

pAffi-PmrB/A-amplifier has the backbone of pET28a, carrying:

designed sequence to express Affi-PmrB
gene sequence to express PmrA
IPTG-inducible promoter, driving the expression of Affi-PmrB and PmrA
promoter PmrC, driving the expression of T3 σ
T7 core
EGFP as the reporter gene
resistance marker CmR for selection

Fig 5. Plasmid design of pAffi-PmrB/A-amplifier.

Cloning Strategies

PCR with high fidelity Q5 polymerase was conducted to amplify fragments and linearize vectors. Fragments and linearized vectors were assembled by NEBuilder® HiFi DNA assesmbly. Amplifier was added to plasmid pAffi-PmrB/A.

Construction Results

Affi-PmrB-PmrA
PmrC
T7T3 amplifier-EGFP

Fig 6. Construction result of pAffi-PmrB/A-amplifier.

Wetlab Verification

Characterization of Affi-PmrB/A system

We transformed plasmid pAffi-PmrB/A into E. coli for verification. IPTG was used to induce the expression of Affi-PmrB receptor and PmrA protein, and human IgG antibody was added to the experimental group. The fluorescence of EGFP was observed under fluorescence microscope. Our results demonstrated that the fluorescence signal was much stronger with antibody induction, indicating that our Affi-PmrB/A system can efficiently detect and respond to target protein signals.

Fig 7. Fluorescence microscopy of Affi-PmrB/A system.
Plasmid pAffi-PmrB/A was induced with IPTG (final concentration 0.24 mg/mL). The experimental group (B and D) was then induced with 100 mM human IgG antibody, while the control group (A and C) did not add any antibody. Photos were taken under confocal fluorescence microscope (60×).

To increase fluorescence intensity, we designed a new Affi-PmrB variant with more amino acids from PmrB retained. The amino acid 34-37 and 62-64 of PmrB, which exactly flank the transmembrane domain at the outer-membrane compartment, were retained to separate the recognition domain and the transmembrane domain. Then we applied fluorescence spectrophotometry to measure the fluorescence intensity by microplate reader. Our results confirmed that the fluorescence intensity was much higher in the experimental group with antibody induction.

Fig 8. Fluorescence spectrophotometry of Affi-PmrB/A system.
Plasmid pAffi-PmrB/A was induced with IPTG (final concentration 0.24 mg/mL). The experimental group was then induced with 100 mM human IgG antibody, while the control group did not add any antibody. Fluorescence intensity of EGFP was measured by microplate reader. Averaged results from parallel repetition groups were recorded.

Characterization of Affi-PmrB/A-amplifier system

Although the function of Affi-PmrB/A system had been verified, the fluorescence signal output by the engineered bacteria was very weak. Since our goal was to observe the fluorescence signal with naked eyes, we introduced the T7-T3 cascade amplifier into our Affi-Pmr system to amplify the output fluorescence signal output. The fluorescence spectrophotometry results demonstrated the effectiveness of signal amplification since the increase of fluorescence intensity before and after antibody induction was much higher compared to the Affi-PmrB/A system without amplifier.

Fig 9. Fluorescence spectrophotometry of Affi-PmrB/A-amplifier system.
Plasmid pAffi-PmrB/A-amplifier was induced with IPTG (final concentration 0.24 mg/mL). The experimental group was then induced with 100 mM human IgG antibody, while the control group did not add any antibody. Fluorescence intensity of EGFP was measured by microplate reader. Averaged results from parallel repetition groups were recorded.

Affi-NisK/R System

Plasmid Construction

pNisinOE1

Plasmid Design

pNisinOE1 is a pET28a-based plasmid for nisin induced green fluorescence detection carrying:

NisK and NisR under the control of T7 promoter and lac operator
inducible promoter PnisA
EGFP as the reporter gene
resistance marker KanR for selection

Fig 10. Plasmid design of pNisinOE1.

Cloning Strategies

NisK, NisR, and PnisA sequences were synthesized according to information on UniProt. PCR with high fidelity Q5 polymerase was conducted to amplify fragments and linearize vectors. Fragments and linearized vectors were assembled by NEBuilder® HiFi DNA assesmbly.

Construction Results

NisK+NisR
PnisA+EGFP

Fig 11. Construction result of pNisinOE1 for nisin-induced fluorescence detection.

pNisinOE2

Plasmid Design

pNisinOE2 is a nisin induced lacZ expression plasmid derived from pNisinOE1 with the only difference that the EGFP gene is changed into lacZα.

Fig 12. Plasmid design of pNisinOE2.

Cloning Strategies

lacZ fragment from pUC19 plasmid was amplified by PCR and assembled with PCR linearized pNisinOE1 (left out EGFP gene) using NEBuilder® HiFi DNA assesmbly.

Construction Results

NisK+NisR
PnisA+lacZ

Fig 13. Construction result of pNisinOE2 for nisin-induced lacZ expression.

pNisin1

Plasmid Design

pNisin1 is a pFB20-based plasmid (gift from Fang Ba) for nisin induced lacZ expression with constitutive NisK and NisR expression, carrying:

NisK and NisR under the control of constitutive promoter J23100 and his operon terminator
inducible promoter PnisA
lacZα as the reporter gene
resistance marker cmR for selection

Fig 14. Plasmid design of pNisin1.

Cloning Strategies

First, PnisA and lacZα fragments were amplified separately by PCR and HiFi assembled with PCR linearized pFB20 outside J23100 and bacterial terminator, generating an intermediate product.
Then nisK and nisR fragment amplified from pNisinOE1 was assembled with PCR linearized intermediate product outside J23100 and his operon terminator to form final product pNisin1.

Construction Results

lacZ+PnisA+NisK+NisR

Fig 15. Construction result of pNisin1 for nisin-induced lacZ expression with constitutive NisK and NisR expression.

pNisin2

Plasmid Design

pNisin2 is our final plasmid for constitutive two-component system expression and nisin induced EGFP expression, derived from pNisin1 with the only difference that the lacZα gene is changed into EGFP.

Fig 16. Plasmid design of pNisin2.

Cloning Strategies

EGFP fragment from pNisinOE1 was amplified by PCR and assembled with PCR linearized pNisin1 (left out lacZ gene) using NEBuilder® HiFi DNA assesmbly.

Construction Results

EGFP+PnisA+NisK+NisR

Construction result of pNisin2 for nisin-induced fluorescence detection with constitutive NisK and NisR expression.

Fig 17. Construction result of pNisin2 for nisin-induced fluorescence detection with constitutive NisK and NisR expression.

pConfocal

Plasmid Design

pConfocal is a pFB20-based plasmid (gift from Fang Ba) for constitutive NisK-EGFP fusion protein expression carrying:

NisK and EGFP fusion gene under the control of constitutive promoter J23100 and his operon terminator
inducible promoter PnisA followed by lacZα (unnecessary for localization observation)
resistance marker cmR for selection

Fig 18. Plasmid design of pConfocal.

Cloning Strategies

EGFP fragment from pNisinOE1 was amplified by PCR and assembled with PCR linearized pNisin1 (left out nisR gene) using HiFi Assembly.

Construction Results

NisK+EGFP

Construction result of pConfocal for constitutive NisK-EGFP localization.

Fig 19. Construction result of pConfocal for constitutive NisK-EGFP localization.

pNisAB & pNisC

Plasmid Design

pNisAB and pNisC are both pET-28a based plasmid for NisA-affi production, carrying:

NisA-affibody with 6xHis tag at C terminal
NisB and NisC responsible for nisA-affibody modification
T7 promoter and lac operator. driving the expression of NisA-affibody, NisB, and NisC
resistance marker KanR or CmR for selection

Fig 20. Plasmid design of pNisAB and pNisC.

Cloning Strategies

PCR amplified NisA-affibody gene and NisB gene were assembled with PCR linearized pET28a(kanR). PCR amplified NisC gene was assembled with PCR linearized pET28a(cmR).

Construction Results

NisA-affibody+NisB
NisC

Fig 21. Construction result of pNisAB and pNisC for NisA-affibody expression.

Verification of overexpressed nisin TCS

To test whether nisin TCS can function correctly in E.coli, we transformed pNisinOE1 into E.coli strain BL21(DE3) and induced NisK and NisR expression by IPTG. NisR expression was detected by SDS-PAGE (Fig.22). However, we didn’t detect NisK in SDS-PAGE, probably due to its membrane-bound localization.

Fig 22. SDS-PAGE result of NisR expression.

Then we tried to induce nisin TCS to function using multiple concentration of nisin. Fluorescence spectrophotometry results by microplate reader demonstrated that the optimal concentration of nisin induction was 1.0 ng/mL (Fig.23). Observation under fluorescence microscope also confirmed that EGFP expression was enhanced when 1.0 ng/ml nisin was added(Fig.24).

Fig 23.pNisinOE1 nisin induction results by microplate reader.
Plasmid pNisinOE1 was induced with multiple concentration of nisin. OD600 was measured to normalize the density of bacteria solution. Fluorescence intensity of EGFP was measured by microplate reader. Averaged results from parallel repetition groups were recorded.

Fig 24.pNisinOE1 nisin induction results under fluorescence microscope.
Plasmid pNisinOE1 was induced with 1.0 ng/mL nisin. Photos were taken under fluorescence microscope (100x).

Noticing that EGFP expression induced by nisin could only be viewed under microplate reader or fluorescence microscope, we tried to use lacZ as a replacement of EGFP to be the reporter gene so as to have a better detection signal visible without microplate reader or microscope, given that lacZ expression can be easily visualized when X-gal is added.

We transformed pNisinOE2 plasmid into BL21(DE3) and cultured the bacteria on plates with X-gal, IPTG and different concentrations of nisin. However, we ignored the fact that strain BL21(DE3) could express lacZ constitutively, so all the colonies on all the plates were blue(Fig.25). We also used strain DH5α to repeat this experiment. However, probably due to absence of T7 polymerase gene, the induction was not successful as all the colonies on all the plates were white(Fig.26).

Fig 25.pNisonOE2 nisin induction results in BL21(DE3).

Fig 26. pNisinOE2 nisin induction results in DH5α.

Facing these problems, we decided to constructed lacZ gene knockout BL21(DE3) strain using CRISPR-Cas9 system. We designed four sgRNAs, but unfortunately none of them were effective. Due to time limitation, further knockout experiments were suspended.

Verification of constitutive nisin TCS

In order to create strains that can express NisK and NisR constitutively without induction by IPTG, we constructed two more nisin induced reporter expression plasmids pNisin1 and pNisin2.

To determine whether the constitutively expressed nisin receptor NisK in our system could locate on cell membrane correctly, we transformed pConfocal plasmid into MACH1-T1 and examined it under confocal laser scanning microscope. The imaging result showed stronger fluorescence signal located on bacterial membrane, and fluorescence intensity measured by computer also showed the same distribution(Fig.27), indicating that most NisK-EGFP fusion proteins were located correctly on the membrane.

Fig 27. NisK localization under confocal laser scanning microscope (100x).

After confirming the membrane location of NisK, we transformed pNisin1 plasmid into strain MACH1-T1 and conducted nisin induction assay to obtain a preliminary qualitative result of whether our system could work under constitutive expression. Results showed that the bacteria solution became relatively blue when different concentrations of nisin were added. (Fig.28)

Fig 28. pNisin1 nisin induction results.

To obtain quantitative results of constitutively expressing NisK and NisR, we transformed pNisin2 plasmid into MACH1-T1 strain and measured fluorescence intensity of EGFP by microplate reader after nisin induction at different concentration for different induction time(Fig.29). Results showed that 4-hour induction by nisin obtained relatively better result as 0ng/ml nisin group showed lower fluorescence signal. In addition, results from fluorescence microscope observation of 4-hour induction bacteria confirmed successful induction results as induction group showed stronger fluorescence signal(Fig.30).

Fig 29. pNisin2 nisin induction results by fluorescence spectrophotometry.
Plasmid pNisin2 was induced with nisin of different concentration for different induction time. OD600 was measured to normalize the density of bacteria solution. Fluorescence intensity of EGFP was measured by microplate reader. Averaged results from parallel repetition groups were recorded.

Fig 30. pNisin2 nisin induction results under fluorescence microscope (100x).
Plasmid pNisin2 was induced with 1 ng/mL nisin for 4h. Photos were taken under fluorescence microscope.

To further figure out better nisin concentration for induction, we conducted 4-h induction assay at more detailed nisin concentration(Fig.31), and result showed that 1-2 ng/ml nisin still worked well in constitutive nisin induction system.

Fig 31. pNisin2 nisin 4-hour induction results at detailed induction concentration by fluorescence spectrophotometry.
Plasmid pNisin2 was induced with nisin of different concentration. OD600 was measured to normalize the density of bacteria solution. Fluorescence intensity of EGFP was measured by microplate reader. Averaged results from parallel repetition groups were recorded.

We also conducted flow cytometry for 4h induction bacteria to further validate our results(Fig.32). Flow cytometry results also confirmed relatively successful fluorescence induction by nisin and that 1 ng/mL nisin was the optimal induction concentration for 4h induction.

Fig 32.pNisin2 nisin induction results by flow cytometry.

We also invited HUST-China to conduct the induction assay. However, result of nisin induction assay from HUST-China showed different pattern as 0ng/ml nisin group had relatively high fluorescence signal(Fig.33), probably due to the instability of the system.

Fig 33.pNisin2 nisin induction results by HUST-China by fluorescence spectrophotometry.

Noticing that the result was relatively unstable, and both the fluorescence signals measured by microplate reader and positive bacterial percentage measured by flow cytometry didn’t increase much, which may not fulfill our final goal, we managed to make some improvements to the induction system.

We designed a promoter strength prediction software to perform computer-based directed evolution of enhancing the strength of PnisA promoter. We selected the top 10 mutant promoters generated by the software with the highest predictive promoter strength. The sequences are as follows:

Table 1. Sequences of mutant promoters.
Promoter	Last 50 bases
PnisA	agtttgttagatacaatgatttcgttcgaaggaactacaaaataaattat
PnisRRH01	agtttgttagatactatgacttcgttcgaaggtactacaaaactaattat
PnisRRH02	agtttgttaggtacaatgattttgttccaagtaactacaaaataaattat
PnisRRH03	agtttgttagatacaatgacttcgttcgtaggaactacagactagattat
PnisRRH04	agtttgttagacacaatgattttgttcgaagtaactacaaaataacttat
PnisRRH05	agtttgtgagatacaatgactttgttcgaagtaactacaaaatcaattat
PnisRRH06	agtttgttagttacaatgacttcgttcaaaggaactacaaaataaactat
PnisRRH07	agtttgttacatactatgacttcgttctaaggaactacaaaacaaattat
PnisRRH08	agtttgttagatacaatgatttcgttcaaagtaactacaaactgaattat
PnisRRH09	agtttgttagatacaatgactttgttcgaatgaactacaaaataaactat
PnisRRH10	agtttgttaggtacaatgatttcgttcaaaggaactacaaactaacttat

For more details on this promoter strength prediction software, please visit our Software page.

We introduced these 10 promoters into our plasmid pNisin2 and transformed them into MACH1-T1 strain to detect EGFP fluorescence signal with and without nisin induction by microplate reader. Results demonstrated that fluorescence signals were enhanced both with and without nisin induction except for PnisRRH07 and PnisRRH10(Fig.34).

Fig 34.Fluorescence spectrophotometry results of the 10 mutant promoters with the highest predictive strength.

Furthermore, flow cytometry results confirmed that percentages of positive fluorescence signal bacteria also increased both with and without nisin induction(Fig.35), indicating that the improvement of promoter PnisA by our software tool was practical.

Fig 35.Flow cytometry results of the 10 mutant promoters with the highest predictive strength.

Verification of Affi-NisK/R system

The activation of the nisin induced system by EGFR is mediated by our modified fusion protein NisA-affibody Z_EGFR:2377. For effective NisA-affibody production, we constructed pNisAB and pNisC, and co-transformed them into BL21(DE3). Nis-affibody was expressed and purified using Ni column. Western blots assay targeting 6xHis tag was conducted to detect nisA-affibody expression(Fig.36). However, the enrichment level of nisA-affibody in elution was relatively low, probably due to unstable binding between the fusion protein and the column.

Fig 36.Western blot results to detect NisA-affibody expression.

Then we tried to induce our constitutive nisin TCS using NisA-affibody that we purified. We conducted induction assay in MACH1-T1 strain containing pNisin2 plasmid using different volumn of NisA-affibody elution for different time, and found that 4h induction still worked better(Fig.37).

Fig 37.Fluorescence spectrophotometry results of pNisin2 induction using NisA-affibody.
Plasmid pNisin2 was induced with NisA-affibody elution of different volumn for different induction time.

Then we conducted 4-h induction assay using detailed volumn of NisA-affibody elution and the elution buffer as the control. Fluorescence spectrophotometry results showed that at some volumn induction by NisA-affibody greatly increased fluorescence signal, demonstrating that our constitutive nisin TCS may be successfully induced by the NisA-affibody that we purified. (Fig.38) Flow cytometry results also confirmed the success of our Affi-NisK/R system. (Fig.39)

Fig 38.Fluorescence spectrophotometry results of pNisin2 induction for 4h using NisA-affibody.
Plasmid pNisin2 was induced with NisA-affibody elution and elution buffer of different volumn. OD600 was measured to normalize the density of bacteria solution. Fluorescence intensity of EGFP was measured by microplate reader. Averaged results from parallel repetition groups were recorded.

Fig 39.Flow cytometry results of pNisin2 induction using NisA-affibody.

We also invited HUST-China to conduct the induction assay. However, result of NisA-affibody induction assay from HUST-China showed no significant changes of fluorescence signal(figure not shown), probably due to the instability of the system. Thus, further verification experiments of Affi-NisK/R system still need to be carried out in the future.

Logic Gate

Plasmid Construction

This section presents the success of our plasmid construction . The cloning strategies and construction results for each plasmid are shown as follows. Detailed potocols can be found on the Method page.

pLogic1 for integrase characterization

Plasmid design:

pLogic1 has the backbone of pET28a, carrying:

gene sequence to express serine integrase Bxb1
P_BAD/AraC promoter, driving the expression of serine integrase
OR2-OR1 containing promoter P_R flanked by attP and attB sites
reporter genes to express EGFP and mCherry
resistance marker AmpR for selection

Fig 40. Plasmid design of pLogic1 for inergase characterization.

Cloning strategies

Serine integrase and P_BAD/araC were assembled and inserted into pET28a(Carb)
mCherry-attP-OR-attB-EGFP were assembled and inserted into pET28a(Carb)

Construction result

mCherry-attB-OR-attP-EGFP
integrase Bxb1

Fig 41. Construction result of pLogic1 for inergase characterization.

pLogic2 for cro/cI characterization

Plasmid design

pLogic2 has the backbone of pET28a, carrying:

cro gene to express Cro protein
cI gene to express cI protein
P_BAD/AraC promoter, driving the expression of cro
OR2-OR3 containing promoter PRM, driving the expression of cI
mCherry-attB-OR-attP-EGFP
resistance marker CmR for selection

Plasmid design of pLogic2 for cro/cI characterization

Fig 42. Plasmid design of pLogic2 for inergase characterization.

Cloning Strategies

Fragments were amplified by PCR using the high fidelity Q5 polymerase, whereas vectors were linearized by inverse PCR. Fragments and linearized vectors were assembled by NEBuilder® HiFi DNA assesmbly. We separated the cloning into three steps for an optimum of efficacy:

cro and P_BAD/AraC were assembled and inserted into pET28a(Chl)
cI and OR2-OR3 were assembled and inserted into pET28a(Chl)
mCherry-attP-OR-attB-EGFP were assembled and inserted into pET28a(Chl)

Construction result

mCherry-attB-OR-attP-EGFP
cI
P_BAD/AraC-cro1
P_BAD/AraC-cro2

Fig 43. Construction result of pLogic2 for cro/cI characterization.

Functional Test for PBAD/AraC System

Since the expression of integrase and cro are under the control of inducible P_BAD/AraC system, we first verified the function and intensity of P_BAD promoter by constructing verification plasmids that consist of P_BAD promoter and a reporter gene to express mCherry, and measuring fluorescence intensity by microplate reader. Given that the effect and intensity of P_R promoter within OR1 operator was inconclusive, we compared the promoter intensity with or without OR2-OR1 operator sequence present in the genetic circuit.

Our results proved that the P_BAD/AraC system functioned well under induction. The leakage amount before induction was minor. We also proved that the OR2-OR1 operator imposed minor effect on P_BAD, so it would not affect our subsequent characterization results of integrase and cro/cI.

Fig 44. Functional test for P_BAD/araC system.
Plasmids P_BAD-mCherry and P_BAD-mCherryOR were induced at 37℃ with 1% (w/v) arabinose for 0h, 3h, 6h, and 16h. OD600 was measured to normalize the density of bacteria solution. Fluorescence intensity of mCherry was measured by microplate reader. Averaged results from parallel repetition groups were recorded.

Characterization of Serine Integrase Function

qPCR results

We applied quantitative RT-PCR to measure the inversion efficiency of serine integrase. The primers used in qPCR were designed to amplify sequences in between only after inversion caused by integrase. We analyzed the inversion efficiency of serine integrase by measuring the Ct values of qPCR before and after arabinose induction. The influence of bacterial amount on the Ct values of target gene was blanked by measuring the Ct value of a reference gene (resistance marker gene on the plasmid vector).

After intricate analysis, we summarized valid data and performed regression analysis to test our detection. (Table.2) Even though the exact inversion efficiency cannot be determined, relative magnitude demonstrated that our system induced a two-fold increase in the ratio of inversed promoter sequence. (Fig. 45)

Table 2. qPCR results of serine integrase characterization.
Induction temperature (℃)	Induction time (h)	Target sequence Ct (unit)	Reference sequence Ct (unit)
Group 1	Induced	32.9	32.18
Group 1	Not induced	35.07	31.72
Group 2	Induced	14.195	14.655
Group 2	Not induced	14.91	13.615
Group 3	Induced	14.905	15.28
Group 3	Not induced	14.975	15.025
Group 4	Induced	13.834	14.705
Group 4	Not induced	14.785	13.325
Regression analysis	Induced	- 0.8791 * p + q - 0.8961 = 0
Regression analysis	Not induced	- 0.9299 * p + q - 1.5752 = 0

Fig 45. Characterization of serine integrase inversion efficiency by RT-qPCR. An exemplary qP graph (left) and the regression results (right).

The detailed formula deduction and intricate analysis are as follows.

Fig 46. Detailed deduction of qP analysis.

Click To Know More

Fluorescence spectrophotometry results

We applied fluorescence spectrophotometry to measure the fluorescence intensity of the reporter protein by microplate reader to characterize the inversion efficiency of serine integrase. Before inversion, P_R promoter within the OR2-OR1 operator drives the expression of EGFP. In contrast, after inversion caused by integrase, P_R promoter drives the expression of mCherry.

Our results showed that the fluorescence intensity of mCherry increased significantly after arabinose induction, indicating high inversion efficiency of serine integrase.

Fig 47. Characterization of serine integrase function by fluorescence spectrophotometry.
Plasmid pLogic1 was induced with 1% (w/v) arabinose for 0h, 3h, 6h, and 16h at 37℃. OD600 was measured to normalize the density of bacteria solution. Fluorescence intensity of mCherry was measured by microplate reader. Averaged results from parallel repetition groups were recorded.

Characterization of cro/cI Function

Plasmid pLogic2 was designed for characterization of cro/cI function. We applied fluorescence spectrophotometry to measure the fluorescence intensity of reporter protein EGFP by microplate reader.

Our results showed a significant decrease of fluorescence signal before induction when cI was expressed constitutively, indicating that cI associated with OR promoters to repress downstream reporter gene expression. The fluorescence signal increased when cro was expressed under arabinose induction, suggesting that cro successfully blocked the transcription of cI and derepressed the inhibition effect induced by cI. It is worth mentioning that we examined two homologous cro proteins with different sequences that both matched an identical cI protein and received similar results.

Fig 48. Characterization of cro/cI function by fluorescence spectrophotometry.
Negative control: pET28a(Chl) vector; Postive control: pET28a(Chl) carrying mCherry-attP-OR-attB-EGFP; cI: pLogic2 w/o induction; cro: pLogic2 with 1% (w/v) arabinose induction for 16h at 16℃ or 37℃. OD600 was measured to normalize the density of bacteria solution. Fluorescence intensity of EGFP was measured by microplate reader. Averaged results from parallel repetition groups were recorded.

Reporter System

To enable the engineered bacteria to report assay results in a visulizable way, two color proteins were selected: EiraCFP and mCherry. mCherry is red in natural light; EiraCFP was added to the part registry in 2014, which is colorless in natural light and blue in UV excitation light. Therefore, mixtures with different ratios of these two proteins will be able to show different degrees of red and blue color in natural light and UV light, respectively, while minimizing the interference between them due to the different excitation light.

We made colorimetric cards by mixing bacteria expressing color proteins in different ratios. This demonstrated the feasibility of selecting these two color proteins as reporters of our detection system.

Fig 49. Colometric of mCherry (upper panel) and EiraCFP (lower panel).