Welcome to the engineering success page!
Here we describe the development of our project: How, as we progressed, we discovered new challenges which forced us to find new solutions and initiate new engineering cycles. In this section you will see that the development of our project was not a linear process as presented in our Results.
To find a solution to a problem through synthetic biology, it is necessary to follow iterations of the DBTL (Design, Build, Test, Learn) cycle. This cycle generates a bridge between the problem with science and the technologies to be implemented (Lawson et al., 2019).
With Agrocapsi, we aimed to develop a biofungicide that would help prevent wilt. Nonetheless, we wanted a product without the adverse effects that current agrochemicals have. Behind the obtained results there was a lot of hard work that went through key decision-making moments that shaped the project to what it is today.
In synthetic biology these iterations of the DBTL cycle are very common. No matter how carefully we design the constructs, the experiments do not always work as planned. Throughout the project we have performed a lot of DBTL cycles. Below are some of the most significant ones for our project. Click on each of them to learn more.
Design:
Through our modeling, we sought to determine the optimal concentrations of IPTG and an appropriate promoter for our expression system. This way, we could achieve our goal of optimizing our production process. Thus, we decided to model the gene expression of an IPTG-inducible and LacI-repressible system in our E. coli BL21(DE3) chassis.
Build:
Once we had the idea, we got down to work. We made a step-by-step diagram showing the two possible scenarios of our expression system: with and without IPTG in the medium. Once we had the diagram we defined the assumptions of our model and described each of the biochemical reaction, and finally we constructed a system of equations based on the law of mass action and mass balance.
In addition, we defined parameters based on a literature review.
Test:
We solved the ordinary differential equations (ODEs) and ran computer simulations to observe the behavior of our plots.
However, the results were not quite as expected. We observed that our system did not behave like in our first laboratory experiments. Our instructor, Ph.D. Roberto Olivares, mentioned that there were 3 aspects that could be causing an inadequate behavior:
Figure 1.First solution to the first model we created.
Errors when writing the equations in our code (since some parentheses or signs were different from the equations we had previously designed).
Errors in the units of our parameters.
Errors in the mass balances.
So we patiently reviewed each of the points recommended by our instructor.
Learn:
We learned that there were steps we were not considering in the mass balances. This allowed us to redesign our system of ODEs by restarting the engineering cycle.
This led us to perform many more DBTL cycles. It was not only to change the mass balances but also to look for other parameters that had similar experimental conditions to ours.
This allowed us to build the model that we present in the Model page.
Design:
At the begining, the first step was defining the antimicrobial molecules to use. We selected the genes of interest, an osmotin and a dermaseptin, as well as the biobricks needed to build our expression insert. The assembly design was first performed in silico in SnapGene by adding the standard biobricks prefix and suffix and making ligations between promoters [BBa_R0010, BBa_R0011], RBS [BBa_B0032], the coding sequence of interest and the double terminator [BBa_ B0015], as shown in Figure 2. Then, the sequences were optimized for E. coli and finally requested to IDT as part of the sponsorship.
Figure 2. Examples of designed sequences. A) Expression cassette for PcOSM peptide with DsbA. B) Expression cassette for (CBD)2-DrsB1 peptide with DsbA. C) Expression cassette for PcOSM peptide. D) Expression cassette for (CBD)2-DrsB1 peptide.
Build:
After receiving the sequences from IDT, we performed the proper digestion of the fragments using EcoRI and PstI as advised by the provider. The linearized plasmid pSB1C3 that we had from earlier editions was likewise digested. A LacI regulated promoter BioBrick [BBa_R0010] plasmid was simultaneously digested as a control as demonstrated in Figure 3. With this gel we verified the correct activity of our enzymes and digestion conditions. We then proceeded to perform the ligation protocol of our inserts with the pSB1C3 vector.
Figure 3. LacI regulated promoter BioBrick [BBa_R0010] digested with different enzymes in a 0.8% agarose gel. Expected band size: 2268 bp. A) QuickLoad Purple Plus DNA Ladder. B) LacI regulated promoter BioBrick uncutted. C) BBa_R0010 digested with EcoRI. D) BBa_R0010 digested with XbaI. E) BBa_R0010 digested with PstI. F) BBa_R0010 digested with SpeI (2017). G) BBa_R0010 digested with SpeI (2018).
Test:
The ligation product was transformed into E. coli BL21 (DE3) by heat shock and then inoculated into medium containing chloramphenicol. Unfortunately, we did not obtain transformed clones with any of our constructs, so we concluded that something was wrong with our protocols or design.
Learn:
After analyzing the possible sources of error we realized that for efficient cleavage, our insert needed to have extra base pairs at the end of the recognition site. This need was corroborated with the gel shown in Figure 3, where defined bands could be seen due to the cuts made by the enzymes in a sequence that had the required base pairs flanking the recognition site. In other words, the LacI regulated promoter BioBrick in Figure 3 could be digested correctly because it was a circular construct. However, the fragments of interest were linear inserts whose ends were flanked only by the suffix and prefix. Having said that, we had to go through a new engineering cycle to prove this new hypothesis.
Design:
Following the learnings from the previous cycle, we carefully analyzed the manufacturer's considerations for each enzyme to know the number of base pairs needed for the cleavage. After evaluating the options, designing and synthesizing primers for a PCR amplification was the most viable option for us. The primers were first created in silico in SnapGene to hybridize to the prefix and suffix of each part. Once we obtained these sequences, we had them synthesized in order to continue our work.
Build:
It was important to develop the protocol taking into account the melting temperature (Tm) of our primers as well as the number of cycles, phase temperatures, and timings to perform PCR of the sequences we already had.
At this point, the amount of insert left to work was low, due to our previous attempts to ligate our IDT sequences. This didn't allow us to commit any errors. As a result, we decided to test our primers using some sequences that were left over from from previous teams. The prefix and suffix that were used to construct these fragments, along with the fact that our primers were made to hybridize to these sequences, should theoretically lead them to amplify. This amplification had the result depicted in Figure 4.
Figure 4. Sequences from prior teams, abaecin and defensin in 0.8% agarose gel after amplification with prefix and sufix specific primers. A) QuickLoad Purple Plus DNA Ladder. B) Abaecin sequence (361 pb) at Ta= 50° C. C) Defensin sequence (415 pb) at Ta= 55° C. D) Abaecin sequence (361 pb) at Ta= 55° C. E) Defensin sequence (415 pb)at Ta= 55° C.
Test:
We carried out PCRs with our fragments under the same conditions after confirming that our primers were effective and amplifying sequences with prefixes and suffixes. However, there was no banding or amplification visible in the electrophoresis gels Figure 5.
Figure 5. Project sequences PelB-(CBD)2-DrsB1 with DsbA, (CBD)2-DrsB1, DrsB1 construct with LacI Promoter, and PcOSM construct with DsbA in 0.8% agarose gel after amplification with prefix and sufix specific primers. A) QuickLoad Purple Plus DNA Ladder. B) PelB-(CBD)2-DrsB1 construct with DsbA (1738 bp) at Ta= 50 °C. C) Expression construct for (CBD)2-DrsB1 (1075 bp) at Ta= 50 °C. D) DrsB1 Construct with LacI Promoter (481 bp) at Ta= 50° C. E) PcOSM Construct with DsbA (1738 bp) at Ta= 50° C. F) QuickLoad Purple Plus DNA Ladder. G) PelB-(CBD)2-DrsB1 Construct with DsbA at Ta= 55° C. H) Expression construct for (CBD)2-DrsB1 at Ta= 55° C. I) DrsB1 Construct with LacI Promoter at Ta= 55° C. J) PcOSM Construct with DsbA at Ta= 55° C.
Learn:
We could tell from the gel's results that the DNA was not in great condition, which is why none of the fragments were amplified. The fact that they were huge fragments, as IDT said, made the PCR challenging to carry out. We notified the corporation about these difficulties, justifying our hypothesis, and they agreed to replace the damaged sequences.
However, in our region it is common to wait quite a long time for synthesis products and molecular reagents to arrive, since they all have to be imported and are usually held up in Customs and Border Protection for some time. In this edition, it was particularly challenging as the waiting times were up to months. As a result, we had to reconsider our alternatives.
Design:
Although IDT very kindly accepted the replacement of the damaged DNA, due to the lack of time, we considered the sponsorship of Twist Bioscience for a new order. Before placing the order, the constructs were modified and optimized again. We added adapters to both ends, which provided the additional nucleotides required for effective digestion. This allowed us to avoid a PCR amplification and eliminate the risk of obtaining sequences with a mutation with our low fildelity polymerase. At this time, we could established contact with the parcel delivery company, which accelerated this subsequent shipments a bit.
Build:
We were able to digest the vector and inserts with EcoRI and PstI as soon as the sequences with adapters arrived. But then, the ligation technique planned was not working either, so we had to create a shorter engineering cycle. We experimented with altering the insert and vector ratios, beginning with the molar ratios recommended by the manufacturer (3:1, 5:1, and 7:1). None of the ratios worked. We subsequently decided to carry out this protocol's assembly using mass ratios and plasmid dephosphorylation. In one of the ligation experiments, we did see colonies after transformation. Thus we deduced that the ideal circumstances were with the vector dephosphorylated at a 3:1 ratio of insert and plasmid, respectively.
Test:
The ligation product was transformed into E. coli BL21 (DE3) by heat shock and then inoculated into medium containing kanamycin. This time, we were able to produce positive clones. When this procedure was repeated for a subsequent ligation, we likewise got favorable outcomes.
Learn:
With the results achieved, all the relevant methods, including digestion, ligation, and the transformation of the E. coli strain, could be standardized. Finally, we used colony PCR to confirm that these steps were proper and that our inserts were in fact present in the bacteria. The findings are depicted in Figure 6.
Figure 6. Colony PCR from clones with mCherry (RFP) construct with LacI promoter, (CBD)2-DrsB1 construct, PcOSM construct with LacI promoter, and mCherry (RFP) construct with lambda pL hybrid promoter in 0.8% agarose gel. A) QuickLoad Purple Plus DNA Ladder. B) mCherry (RFP) construct with LacI regulated promoter (1137 bp) at Ta= 50° C. C)Expression construct for (CBD)2-DrsB1 (1134 bp) at Ta= 50° C. D) PcOSM Construct with LacI regulated promoter (1134) at Ta= 50° C. E) mCherry (RFP) construct with LacI regulated, lambda pL hybrid promoter (992 bp) at Ta= 50° C. F) PcOSM construct with DsbA (1797 bp) at Ta= 50° C.
We have confirmed that now we have transformed cells with our expression vectors!
Design:
Once we obtained successful transformations, we used isopropyl-D-1-thiogalactopyranoside (IPTG) to induce expression, since both promoters selected (regulated LacI promoter and lambda pL promoter hybrid) were inducible by it. To determine the best induction concentration, we created a protocol with different concentrations of IPTG. To visualize the induction results, an SDS-PAGE protocol was followed. The weights of our proteins are 4 kDa for DrsB1 (the existing part), 25 kDa for improved DrsB1, and 25.6 kDa for PcOSM with LacI promoter.
Build:
The induction was carried out using a kinetic at IPTG concentrations of 0 mM, 0.1 mM, 0.5 mM, and 1 mM with 6 hours of incubation. This would enable us to determine the level of IPTG at which the highest synthesis of our target molecules will occur. Additionally, an SDS-PAGE methodology that was appropriate for the protein weight was developed, and it was decided to create acrylamide gels made up of concentrator and separator gels at 6% and 12%, respectively.
Test:
Centrifugation was used to separate the soluble and insoluble fractions from each culture of E. coli BL21 (DE3) that had been transformed and induced at the appropriate IPTG concentration. Increasing concentrations of each fraction were put onto SDS-PAGE gels. To compare the banding pattern, an untransformed induced E. coli BL21 (DE3) control was loaded. Mercaptoethanol and a brilliant blue-based loading buffer were used to prep the samples. For 20 minutes at 80 V and 35 minutes at 180 V, these gels were tested. As demonstrated in Figure 7, it was easy to see that the proteins of interest were absent from both soluble and insoluble fractions after staining and destaining. The lack of a difference in the banding pattern between the control sample and the relevant samples in the targeted weight region allowed for the deduction that the protein was absent.
Figure 7. SDS-PAGE of soluble and insoluble protein fractions obtained from a culture media induced by different IPTG concentrations for 6 hours. A) Page Ruler ™ Low Range Unstained Protein Ladder.B) E. coli BL21 Induced with IPTG 1 mM C) DrsB1 existing induced with IPTG 0 mM soluble fraction. D) DrsB1 existing induced with IPTG 0 mM insoluble fraction. E) DrsB1 existing induced with IPTG 0.1 mM soluble fraction. F) DrsB1 existing induced with IPTG 0.1 mM insoluble fraction. G) DrsB1 existing induced with IPTG 0.5 mM soluble fraction H) DrsB1 existing induced with IPTG 0.5 mM insoluble fraction. I) DrsB1 existing induced with IPTG 1 mM soluble fraction. J) DrsB1 existing induced with IPTG 1 mM insoluble fraction.
Learn:
Different hypotheses were considered when unfavorable results with induction were observed. A possible defect in the design of the constructs, particularly in the promoter region, was one of the things we thought might have played an important role. Also, the IPTG used could not be in the best condition due to the expiration date, which may have contributed to the failure to promote induction.
There are many sources of error in having induced these sequences for the first time. It is possible that the experiment was not performed at the proper concentrations and/or time, or that the protocol that was established suffered from an error in execution. Therefore, it was necessary to introduce a new engineering cycle.
Design:
To confirm which of our hypotheses was true and to find the reason why our protein did not seem to be expressed, we decided to reduce the variables to make the analysis easier.
We set up induction kinetics with expression cassettes identical to the ones we used to express our peptides. Only this time we replaced our peptides with a flourescent protein: mCherry.
Likewise, we used as a control a vector we had in the laboratory. This vector consisted of a pET28 expressing another mCherry protein. This construct, despite having a different promoter, was also inducible by IPTG like ours, so it could either confirm or refute some of our hypotheses. However, it was decided to redesign the protocol to collect samples at different induction times with varying inducer concentrations.
Build:
Colonies of E. coli BL21 (DE3) previously transformed with the constructs of interest were grown until they reached an OD600 of 0.4 to 0.6. Once this OD600 was reached, IPTG was added at different concentrations to start induction (0 mM, 0.1 mM, 0.5 mM and 1 mM).
This time we used a different IPTG stock than the one used in the previous cycle. We also took samples at different times (1h, 2h, 8h) to determine concentration and optimal induction time.
Test:
After induction, an SDS-PAGE was set up. Specifically, the soluble fraction of the transformed bacteria was loaded. Untransformed E. coli BL21 (DE3) strain with and without induction was used as a control. The gels were run at 80 V for 20 min, and at 180 V for 35 min. The results of the gels are shown in Figures 8 and 9. The expected protein was observed, but no induction was noticed.
Figure 8. A) Page Ruler ™ Low Range Unstained Protein Ladder. B) BL21 (DE3) without induction. C) BL21 (DE3) induced 1 mM. D) mCherry control with 0 mM 1 hour. E) mCherry control 0.1 mM 1 hour F) mCherry control 0.5 mM 1 hour. G) mCherry control 1 mM 1 hour. H) mCherry control 0 mM 2 hours. I) mCherry control 0.1 mM 2 hours. J) mCherry control 0.5 mM 2 hours.
Figure 9. Polyacrylamide gel 12% for visualization of the SDS-PAGE results of the mCherry control and mCherry-Hybrid promoter construct. The expected band size of the mCherry control is 31.1 kDa and 26.7kDa for mCherry-Hybrid promoter. A) Page Ruler ™ Low Range Unstained Protein Ladder. B) mCherry control 0 mM 8 hours. C) mCherry control 0.1 mM 8 hours. D) mCherry control 0.5 mM 8 hours. E) mCherry control 1 mM 8 hours. F) mCherry-Hybrid promoter 0 mM 1 hour. G) mCherry-Hybrid promoter 0.1 mM 1 hour. H) mCherry-Hybrid promoter 0.5 mM 1 hour. I) mCherry-Hybrid promoter 1 mM 1 hour. J) mCherry-Hybrid promoter 0 mM 2 hours.
Learn:
Although the banding pattern on the gels indicated the presence of protein, we can deduce that in both cases we obtained partially positive results because we could see protein expression but not regulation through IPTG induction. This was determined by comparing the bands of each construct in non-induced and induced samples (Figures 8 and 9). Although the results were not as expected, we can rescue one positive aspect of this experiment: we were able to observe the activity (although constitutive) of the promoters. Furthermore, as a second benefit, these experiments allowed for the reduction of variables that could be sources of error. However, we had to evaluate the factors that still remained to be considered.
The possibility that the induction protocol did not work was raised because it was executed at different times by all members of the laboratory area. If it had been assembled by only one person, the possibility of human error would have been reduced. As a result, this is something we would change in a future assembly. On the other hand, these results were consistent with those obtained from a fluorescence assay. The data obtained from this assay, however, were not completely reliable due to a high variance caused by several factors, including the type of plate used, which was neither black nor opaque, as well as the reading configuration and direction. Furthermore, we consider performing this test directly in the location where the reading will be performed in future assemblies, because the transport of the plates could have been influenced by some mishandling of the plates during the journey.
We would also experiment with different induction temperatures to see if this played a role in the results. It has been shown that lowering the temperature at which the protein is expressed may be the most simple and successful method of obtaining protein (Duong-Ly, 2014). That's why in the future experiments we will try induction from 15–28 °C, a range that has been tested and used successfully (Kang et al., 2003).
Design:
For siRNA design we performed a literature search to find candidate genes involved in the pathogenicity or viability of the oomycete. One of the strongest candidate genes to be silenced were those encoding for the RXLR effector proteins of P. capsici. These proteins suppress the plant immune system, and are one of the reasons why P. capsici is such an aggressive pathogen.
Once we selected the gene we began to design the sequence of the siRNA we planned to produce. For this we used the online tool E-RNAi (Horn & Boutros, 2010).
For siRNA selection we followed the following considerations (Fakhr et al., 2016):
The first nucleotide of the siRNA sequence can either be an A or a G.
Choose sequences with low GC content.
Avoid 5' and 3'UTRs.
Select a ~21 nt sequences in the target mRNA.
Also, in collaboration with the Tec-Monterrey team, we performed an analysis of the thermodynamic properties of our sequence. For this we used a tool they developed to evaluate the relative efficiency of siRNAs, where the worst siRNAs have an efficiency of 0 and the best ones have an efficiency close to 100. Our siRNA showed an efficiency of 93%. You can read more on the siRNA registration page.
We then analyzed homology with other species using BLAST, thus maintaining the biosafety of other living organisms.
Build:
In the future, we plan to assemble the Up and Down sequences of the expression cassette. For this purpose, a 3A assembly will be performed: the Up part will be cut with EcoRI and SpeI enzymes. The Down part will be cut with XbaI and PstI enzymes. And the vector where they will be inserted will be cut with EcoRI and PstI enzymes (Figure 11).
Figure 11. Expression cassette assembly method for siRNA production. Inspired by the Ecuador 2021 team..
E. coli HT115 cells will be transformed with this vector.
Test:
To corroborate the correct transformation of the cells, a PCR of the colonies grown in the medium with antibiotics will be performed. The primers shown below will be used for this purpose.
| PRIMER 1 | GTTTCTTCCTGCAGCGGCCGCTACTAG |
|---|---|
| PRIMER 2 | GTTTCTTCGAATTCGCGGCCGCTTCTA |
It is expected to have a gel as shown in Figure 12 to confirm the presence of the inserts.
Figure 12. Simulation of a 1% agarose gel with the 1 kb Plus DNA Ladder Molecular Weight Marker. Colony PCR amplicon is observed confirming the presence of the insert.
Learn:
Once the transformed colonies are obtained, we can proceed to the production of the molecules of interest. We know that it will most likely take many more iterations to complete this cycle.
Design:
To prove that our siRNA works we plan to perform an inhibition assay. PhD. Estefanía Ramírez, recommended us to perform our inhibition assays in vitro growing chilli plants in V8 liquid medium and placing an inoculum of P. capsici so that the pathogen is active. Afterwards, we would place the different RNAi treatments on that medium.
The experimental design is shown in Figure 13.
Figure 13. Experimental design of assay testing effect of siRNA on pathogenicity of P. capsici. Concentrations were defined based on previous experiments (Cheng et al., 2022).
Build:
Once the experiment was set up, disease lesions will be measured twice a day, along with the optical density of the culture to know the growth of the pathogen.
Test:
A qualitative analysis of the data will be performed. And it will be determined whether siRNA has an effect on the pathogenicity of P. capsici.
Learn:
In case we observe a positive effect we could perform a more reliable assay, such as real-time PCR. For this, the corresponding primers should be made to measure the effect of the siRNAs on the expression of the gene decided.
This type of assay will be able to confirm what we observed in the qualitative assay.
If necessary, the siRNAs should be redesigned.
Cheng, W., Lin, M., Chu, M., Xiang, G., Guo, J., Jiang, Y., ... & He, S. (2022). RNAi-Based Gene Silencing of RXLR Effectors Protects Plants Against the Oomycete Pathogen Phytophthora capsici. Molecular Plant-Microbe Interactions, 35(6), 440-449.
Fakhr, E., Zare, F., & Teimoori-Toolabi, L. (2016). Precise and efficient siRNA design: a key point in competent gene silencing. Cancer gene therapy, 23(4), 73-82.
Horn, T., & Boutros, M. (2010). E-RNAi: a web application for the multi-species design of RNAi reagents—2010 update. Nucleic acids research, 38(suppl_2), W332-W339.
Lawson, C. E., Harcombe, W. R., Hatzenpichler, R., Lindemann, S. R., Löffler, F. E., O'Malley, M. A., García Martín, H., Pfleger, B. F., Raskin, L., Venturelli, O. S., Weissbrodt, D. G., Noguera, D. R., & McMahon, K. D. (2019). Common principles and best practices for engineering microbiomes. Nature reviews. Microbiology, 17(12), 725–741. https://doi.org/10.1038/s41579-019-0255-9
