Engineering Success

For our final goal of producing natural sorbents, we attempted to selectively degrade cellulose, a hydrophilic substance, by creating genetically engineered bacteria that can secrete cellulose-degrading enzymes. We had to let the enzyme produced by the bacteria be secreted to simplify the degradation process. However, since it is impossible to confirm all the previously known secretion signals, 12 secretion signals were selected by referring to the literature search and the results of TU_Dresden who participated in iGEM in 2017. A signal peptide library plasmid was designed so that 12 secretion signals were selected for the coding sequence of each enzyme and cut into NdeI and NcoI for use.

[Figure 1. Plasmid map of signal peptide library]

We did not digest the plasmid DNA directly with NdeI or NcoI, but cut the library part after amplification using the primers (AIO F- GGATAACCGTATTACCGCCTTTGAG, AIO R- CACAAACAGACGATAACGGCTCTC) shown in Fig. 1 (Fig. 2, 3). Secretion signal fragments were ligated with the DNA fragments coding for each enzyme with Bacillus and E. coli expression vectors and transformed (Fig. 4).

[Figure 2. PCR product containing the signal peptide library]

[Figure 3. secretion signal fragments digested by NdeI, NcoI]

[Figure 4. Transformation result of plasmid ligated with signal peptide library and cellulases]

The enzymes overexpressed from the plasmid obtained through the screening process were actually used to decompose cellulose. In addition, we demonstrated that it can be used as an oil adsorbent by decomposing cellulose in pine powder using our decomposition device (Fig. 5, 6).

[Figure 5. Cellulose Decomposer]

[Figure 6. The color change of pine tree powder after 12 weeks of reaction.]