Parts
During the project a variety of different parts were used. They have been summarised in table 1. We have used a Tau-GFP plasmid that was given to us by our PI's (figure 1). This plasmid was transformed and expressed in E. coli bacterial culture. The GFP protein was attached to the tau protein, so that the latter could be visualised through naked eye. Moreover, table 1 consists of all the parts used for RCA-LAMP (Rolling circle amplification-loop-mediated isothermal amplification). These parts were obtained by IDT.
Furthermore, the page includes a table of the composite parts used in this project. Composite parts consist of parts that have been formed from the assembly of multiple basic parts. For our project we needed aptamers that could be linked to the recognition sequence to be recognised by the padlock probe. Therefore, we added the recognition sequence to the aptamers through the use of a linker sequence. These were then ordered from IDT.
Table 1. Parts used during the project. All the parts displayed here are basic.
| BioBrick | Parts | Description | Sequence/length |
|---|---|---|---|
| BBa_K4433000 | Tau-EGFP construct in pNIC28-Bsa4 | An expression vector under the control of T7 promoter where the protein tau is fused to the fluorescent protein, eGFP. It is an E. coli plasmid. | 1986 bp |
| BBa_K4433001 | Aptamer 1, IT2e | DNA sequence, taken from Teng et al, 2018, that was used for binding to Tau [1]. | 5’-AATAAGGACTGCTTAGGATTGCGATGATT-3’ |
| BBa_K4433002 | Aptamer 2, IT2c | DNA sequence, taken from Teng et al, 2018, that was used for binding to Tau [1]. | 5’-TGAATAAGGACTGCTTAGGATTGCGATGATTCA-3’ |
| BBa_K4433003 | Linker | A very short DNA sequence that creates a link between the aptamer and recognition sequence. | 5’-ATAATATAAT-3’ |
| BBa_K4433004 | Recognition sequence, p53 | A recognition sequence that is recognized and bound by the padlock probe taken from Marciniak et al. 2008. This initiates amplification. This sequence was also used as a control [2]. | 5′-GGGCGGCATGAACCGGAGGCCCATCCTCACC-3′ |
| BBa_K4433005 | Padlock probe | This sequence was taken from Marciniak et al.,2008 and is first ligated to form a circularised sequence that then has the ability to recognize and bind to the recognition sequence attached to the aptamer [2]. | 5′-GGTTCATGCCGCCCGTTCGGGCAATTCGTTATTGGCCCCTATAGTGAGTCGTATTAGTCTTCTCT ATTGTCACCGTACATCTCGGAATCAAGCTGGCATTATCGATCAGTACCAGTGTAGTACAGCAGCAG CATTGCCGGTGAAATTATCGCCACAGGCCTTTAAATATTCTCGAGGGTGAGGATGGGCCTCC-3′ |
| BBa_K4433006 | FIP | Forward Inner Primer used for amplification taken from Marciniak et al. [2] | 5′-GTGGCGATAATTTCACCGGCTTTTGCATTATCGATCAGTACCAGT-3′ |
| BBa_K4433007 | BIP | Backward Inner Primer used for amplification taken from Marciniak et al. [2] | 5′-GTTCGGGCAATTCGTTATTGGCTTTTACGGTGACAATAGAGAAGAC-3′ |
Figure 1: Tau-GFP plasmid construct. [3]
Table 2: Composite parts used during the project.
| BioBrick | Composite parts | Description | Sequence |
|---|---|---|---|
| BBa_K4433008 | Aptamer 1 (IT2e) + linker + recognition | Aptamer 1 was bound to the linker and to the recognition site for the padlock probe to recognise and bind. | 5’-AATAAGGACTGCTTAGGATTGCGATGATTATAATATAATGGGCGGCATGAACCGGAGGCCCATCCTCACC-3’ |
| BBa_K4433009 | Aptamer 2 (IT2c) + linker + recognition | Aptamer 2 was bound to the linker and to the recognition site for the padlock probe to recognise and bind. | 5’-TGAATAAGGACTGCTTAGGATTGCGATGATTCAATAATATAATGGGCGGCATGAACCGGAGGCCCATCCTCACC-3’ |