Describe the research, experiments, and protocols you used in your iGEM project.
SLICE reactions were performed at a molar ratio of vector:insert=1:2.
1) Add 10x SLICE buffer 2.5 μL, SLiCE 2.5 μL, insert 150 fmol and vector 25fmol. Make the total volume 365μL with D2W, and gently pipette.
2) Incubate in a 37°C water bath for 15 minutes.
3) E. coli JM109 was transformed with the whole amount.
1. Plasmid and ligation sample are inserted into a microtube containing competence cell of 100μL.
2. Leave the mixture on ice for 30 mins.
3. Heat shock(temperature-42℃ for 45 sec).
4. Add 250μL of SOC broth and leave it on a shaking incubator for 1hour(37℃).
5. Add 100μL of incubated mixture is applied to a agar plate containing ampicillin.
InversePCR and PCR were performed using the primers and methods shown below.
The conditions of iPCR were as follows: 94°C for 2 min, [98°C for 10 s, 55°C for 30 s, and 68°C for 150 s] repeats 35 cycles. Then, the sample was held at 4°C.
inversePCR Fw CTTATGGCGACGCTAACATT
Tm：53℃
inversePCR Rv GGGTACCGAGCTCGAATTCA
Tm：57℃
The conditions of PCR were as follows: 94°C for 2 min, [98°C for 10 s, 55°C for 30 s, and 68°C for 90 s] repeats 35 cycles. Then, the sample was held at 4°C.
pMD20 Fw ATGACCATGATTACGCCAAGC Tm:56℃1. Cut out the desired band from the agarose gel using a clean cutter.
2.Place the gel strip in a micro tube and weigh it on an electronic balance.
3.Add Buffer QG at a 1:3 ratio of gel:Buffer QG (100 mg of gel = 100 μl).
4.Incubate at 50°C for 10 minutes. *Vortex the tube every 2-3 minutes to dissolve the gel.
5.When the gel is completely dissolved, check that the mixture is yellow in color.
6. Add the same volume of isopropanol as the gel volume to the sample and mix.
7. Set the QIAquick Spin Column into the 2ml Collection Tube provided.
8. Apply the sample to the QIAquick Column and centrifuge for 1 minute to bind DNA.
9. Discard the flow-through and return the QIAquick Column to the same tube.
10. Add 500µl of Buffer QG to the QIAquick column and centrifuge for 1 minute.
11.Discard the flow-through and return the QIAquick column to the same tube.
12. Add 750µl of Buffer PE to the QIAquick column for washing and centrifuge for 1 minute.
13. Discard the flow-through and return the QIAquick column to the same tube.
14. Allow the column to stand for 2 minutes.
15. Centrifuge the QIAquick column for 1 minute in the provided 2 ml collection tube to remove any residual wash buffer.
16. Place the QIAquick column into a new 1.5 ml micro tube.
17. To increase the DNA concentration, add 30 μl of Buffer EB to the center of the QIAquick membrane, allow the column to stand for 1 minute, and centrifuge for 1 minute.
1. centrifuge (TIBITAN 1min) a 1.5ml tube containing 1ml of the pre-cultured bacteria solution
2.Discard the supernatant so as not to destroy the pellet.
3.Add 1ml of the pre-cultured bacteria solution and centrifuge (TIBITAN 1min).
4.Discard the supernatant twice, 900 μl at a time, so as not to destroy the pellet. 5.Add 200 μl of Solution I, and confirm that the bacteria are completely suspended with a vortex mixer.
6.Add 400 μl of Solution Ⅱ and mix slowly and gently by inversion, and confirm that the solution becomes clear.
7.Add 300 μl of Solution III and mix by vortexing and inverting, and confirm that the solution becomes cloudy and solids appear.
8. centrifuge (10,000G, 40min, 4℃)
9. take out the supernatant only and put it into a new 1.5ml tube to avoid precipitation.
If white precipitate enters the microtubes, centrifuge again.
If any liquid remains, repeat steps 7 and 8 several times.
10. add 2µl of RNase (10mg/ml) and allow to react for 30min at 37°C in a heat block.
11.Add 200 µl of phenol:chloroform (1:1) and stir vigorously.
12. centrifuge (1000G, 5min, 4℃)
13. remove all of the supernatant only, not the interlayer, and put it into a new 1.5ml tube
14. add 200µl of chloroform to the micro tube containing the supernatant, tap the tube, and agitate vigorously
15. centrifuge (10,000 G, 1 min, 4°C)
16. transfer the supernatant (up to 750ml) to a new 1.5ml tube after centrifugation
17.Add the same volume of PEG as the aspirated supernatant.
18.
centrifuge (20,400 G, 40 min, 4°C)
Discard the supernatant and add 700µl of 70% ethanol to it .
19.The white material is plasmid, so pour off the liquid from the opposite side of the white pellet to avoid peeling off the plasmid.
20.
centrifuge (10,000 rpm, 30 min, 4°C)
21. discard the supernatant, turn the microtubes upside down on a Kimwipe, and dry (5~10min)
22. add 30µl of 1×TE to the dried microtubes and dissolve the pellet by pipetting.
1. Set heat block to 37°C.
2.Mix BST and 10×H buffer by tapping, and spin down with TIBITAN.
3.Transfer 18.6 μL of sample from a 1.5-ml tube containing the entire amount of Sample to a new tube.
4.Add 2.0 µL of 10×H buffer.
5.Add 0.2 µL of BSA.
6.Add 0.5 µL each of PSPⅠand EcoRⅠ.
7.After tapping, spin down using TIBITAN.
8.Incubate at 37°C for 3 hours (overnight is also acceptable).v