Engineering
Introduction
In this section we present the engineering process and how we designed different processes in the cycle for our project, Apt4UTI.
Overview
Engineering part is like the heart of every igem project. Using engineering as part of the journey of synthetic biology based projects to get meaningful results is necessary as well as enjoying. We followed the following cycle to complete the engineering part of our project.
Initially, we identified previously discovered aptamers in the same direction as of our project followed by our own target as FimH protein. We did build part by contributing in the BioBrick part. Our test section contains two different approaches, one from the wetlab team and other from the modelling team. During our journey, we learned many things and also brought improvements to the learned parts, which we have mentioned under the learn and Improve section.
Design
Introduction
Our proposed aptamer based kit Apt4UTI kit is an engineered syn-bio device that can be used to detect urinary tract infections in minutes with higher sensitivity and specificity. Aptamer is developed based on the selex process. Selex is of two types, one ligand based selex and another whole cell selex. Ligand based selex approaches target a particular component of target organism which can be protein, DNA etc. whereas in whole cell selex, it is the whole cell is targeted.
Aptamer Production
Method 1: Whole cell based selex approach
We started our project ideas on this approach based on previous research findings, after intense search and readings we got 5 random aptamer sequences which are supposed to bind to uropathogenic bacteria and help in detection of uropathogens.
- Aptamer sequence 1- GGGAGGGGCGGCGAAGGAGTGGCG
- Aptamer sequence 2- GGGCCCGAGTGGCGGTAGTTTCAG
- Aptamer sequence 3- GGGCCGGAGGGGCGCCTGCACCCA
- Aptamer sequence 4- GGCGAGGCAGGGTGCGGGGGCCCG
- Aptamer sequence 5- GGCTTGGCTCCTCACGGGGGGTGA
We placed the order of these 5 aptamer sequences from IDT for further characterization and specificity check. Future prospective- We will test the specificity of each aptamer against negative control and will reach a conclusion of best aptamer sequence.
Method 2: Ligand based approach
Groups of Uropathogenic bacteria have many basic similarities which can be targeted as ligand based approaches for aptamer design. We searched and cited a lot of paper to reach a conclusion on targeting a particular ligand.
Surface structures
Initially we thought to use a surface structure like fimbriae or pilli as a target but upon further citations and careful examinations, we found some drawbacks associated with targeting surface structures as a target
Problem associated with targeting surface structure was that fimbriae and pili have many types and were varying among different uropathogen categories hence targeting one of them is supposed to not provide better specificity and can target only few strains of uropathogens.
Figure: List of virulence factors of different uropathogens.
FimH protein
Upon more careful examinations and readings, we reported FimH as a better target than surface structures as it is common in almost all uropathogens. We ordered the FimH protein sequence from Twist biosciences.
The ordered sequence is:
aaacgtgtgattaccctgtttgcagttctgctgatgggttggagcgttaatgcatggtcatttgcatgtaaaaccgcaaa
tggcaccgcaattccgattggtggtggtagcgcaaatgtttatgttaatctggcaccggcagttaatgttggtcagaatc
tggttgttgatctgagcacccagattttttgccataatgattatccggaaaccatcaccgattatgttaccctgcagcgt
ggtgcagcatatggtggtgttctgagcagctttagcggcaccgtgaaatataacggtagcagctatccgtttccgaccac
cagtgaaacaccgcgtgttgtgtataatagccgtaccgataaaccgtggcctgttgcactgtatctgacaccggttagca
gtgccggtggtgttgcaattaaagcaggtagcctgattgccgttctgattctgcgtcagaccaataactataactccgat
gattttcagtttgtgtggaacatctatgccaataatgatgttgttgttccgacg
Hardware
The method we will be adapting to design kit is known as Aptamer-based lateral flow assay. An LFA system is composed of five parts a pad for sample loading; a conjugate pad containing the conjugate of target-specific recognition molecules with colored or fluorescent particles (CPs); a membrane immobilizing the sensor that recognizes targets at the test line and molecules that capture conjugate from the conjugate pad at the control line; an absorbent pad for wicking the sample liquid flow through the conjugate pad and the membrane; and a supportive backing pad for the system. Generally, LFAs can be divided into two formats: direct assay and competitive assay. For direct assays, target-containing samples infiltrate the conjugate pad where targets bind recognition molecules conjugated with CPs. CPs are detained in the test line, as bound targets contain an immobilized sensor. The remaining CPs are captured and retained by the immobilized CPs binding molecules. As a result, both the test and control lines will be colored. However, if the sample lacks the target, only the control line becomes colored. For competitive format assays, the principle is the same as direct assays, but the result interpretation is reversed, i.e., a two-colored line result indicates negativity and a control-only line indicates positivity.Typically, antibodies comprise both the specific recognition molecules in the conjugate pad and the target-binding biosensors and capture molecules on the membrane. Because nucleotide acid aptamers can recognize targets of interest specifically, antibodies for LFA can be replaced with aptamers. Aptamer-based LFAs (ALFA) offers a more flexible design and the ability to detect a wider range of targets.
Figure: Schematic representation of ALFA.
References:
- Wan, Q., Liu, X. and Zu, Y. (2021). Oligonucleotide aptamers for pathogen detection and infectious disease control. Theranostics, 11(18), pp.9133–9161. DOI: 10.7150/thno.61804
- Schembri, M.A., Hasman, H. and Klemm, P. (2000). Expression and purification of the mannose recognition domain of the FimH adhesin. FEMS Microbiology Letters, 188(2), pp.147–151. DOI: 10.1111/j.1574-6968.2000.tb09186.x
- Savory, N., Nzakizwanayo, J., Abe, K., Yoshida, W., Ferri, S., Dedi, C., Jones, B.V. and Ikebukuro, K. (2014). Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX. Journal of Microbiological Methods, [online] 104, pp.94–100. DOI: 10.1111/j.1574-6968.2000.tb09186.x
- Flores-Mireles, A.L., Walker, J.N., Caparon, M. and Hultgren, S.J. (2015). Urinary Tract infections: epidemiology, Mechanisms of Infection and Treatment Options. Nature Reviews Microbiology, 13(5), pp.269–284. DOI: 10.1038/nrmicro3432
Build
From literature and countless brainstorming sessions, we finalized upon using aptamers to detect the FimH proteins which is a component of type 1 fimbriae which helps in the adhesion of the bacteria to the host in most of the UTIs. Easy detection strategy and high specificity of aptamers made us choose this for our project.
Since our project Apt4UTI focuses on developing a novel aptamer-based diagnostic kit for detecting UTI-causing pathogens, so our team has introduce some coding sequences, some constructs and several other relevant parts as BioBricks in the part registry.
Proposed constructs
Using various basic parts, we assembled them into the required constructs for our project. Check out the constructs in the table below:
| Serial Number | Description | Part Number |
|---|---|---|
| 1 | Apt4UTI C1 | BBa_K4449009 |
| 2 | Apt4UTI C2 | BBa_K4449010 |
| 3 | Apt4UTIC3 | BBa_K4449011 |
These are some of our new basic part that we have used in our construct:
| Serial Number | Description | Part Number |
|---|---|---|
| 1 | Expression of FimH1 gene | BBa_K4449000 |
| 2 | Expression of Fim H2 gene | BBa_K4449001 |
| 3 | Expression of Staphylococcus epidermidis Bap like Bhp gene | BBa_K4449002 |
These are some of primers design by our team for our Apt4UTI construct:
| Serial Number | Description | Part Number |
|---|---|---|
| 1 | pET28b FimH1 F | BBa_K4449003 |
| 2 | pET28b FimH1 R | BBa_K4449004 |
| 3 | pET15b FimH2 F | BBa_K4449005 |
| 4 | pET15b FimH2 R | BBa_K4449006 |
| 5 | pET28b Bhp F | BBa_K4449007 |
| 6 | pET28b Bhp R | BBa_K4449008 |
Building our BioBricks
- To construct Apt4UTIC1, FimH1 which contains the coding sequence of the E.coli UTI89 FimH signal peptide and lectin domain which forms a subunit of Type 1 fimbriae is added, having 6 X His tagged at the C-terminal of Fim H1 protein.
- Apt4UTIC2 composite part is formed by assembling the coding region of FimH2 (534 bp) by performing PCR amplification of the gene sequence derived from pBAD FimH 9X His(Addgene #97305), into the expression vector pET15b+(Novagen, EMD Millipore), in frame with the T7 promoter and N terminal 6 X-His affinity tag of the expression vector.
- Apt4UTIC3 composite part is formed by assembling the coding region of Bhp (6909 bp) into the expression vector pET28b+, in frame with the T7 promoter and 6 X His affinity tag (5617 bp to 675634 bp) of the expression vector.
Visit BioBricks page and the Contribution page for more details.
Test
Summary Wet Lab Test:
We started our wet lab work by growing the E Coli strain ATCC25922 and made the growth curve. Then the competent cells which were transformed with pET28b+ were cultured and the plasmid was isolated from them through different methods (alkaline lysis method and using kits). After calculating the concentration, the plasmid was used for cloning and expression. The plasmid and the vector (FimH) were treated for restriction digestion followed by ligation of the fimH gene (after PCR). These modified pET28b+ plasmids were used for transformation of the e coli strain DH5 alpha.
We are now planning the colony PCR of these transformed cells and after purifying the protein (FimH) we will do the ligand based selex to identify the aptamers with high binding affinity towards the fimH protein and which will then be validated by the whole cell SELEX. And we are also planning to optimize various conditions involved in the reaction.
Summary Modelling Test:
The drylab team will act as a verification mechanism in our aptamer screening process. The In-silico modeling will let us verify the candidate aptamers for the detection kit. Since computational approaches will give an edge over the experimental approach in terms of the resources required, the molecular simulation techniques will let us narrow and verify the aptamer sequence’s affinity towards the target protein and let us make important decisions together with the wet lab in designing our multiplex aptamer library.
Learn & Improve
At the starting of the project, we enlisted all possible methods we needed to do in our project. After enlisting all those methods, we started practicing each one by one. The methods we practiced at the start of the project are:
- Bacterial growth curve: The most basic aspect of the project and it was necessary to practice so that our experiment runs smoothly as we can start working by looking at the different stages of the project. We failed three times to get a better plot. The lesson we learned from it was that don't think that small steps will go smoothly during experiments in biology.
- Plasmid isolation: We started learning this step by alkaline lysis method followed by kit method. Failed 2 times with alkaline lysis method. We succeeded at 3rd time by bringing some changes in the protocols. We did plasmid isolation protocols by 2 different companies (Promega and Qiagen plasmid isolation kit ). Failed in first but succeeded in second.
- Gel electrophoresis: We runned isolated plasmid and succeeded at the first chance, everytime.
- PCR: We did pcr as well and succeeded at the first chance.
- Gel extraction: For the gel extraction, we as a team learned to excise the band in the presence of UV under expert supervision, without exposing ourselves to the UV.
- Cloning:The restriction and ligation step took some time due to handling error. we had to repeat and optimize it. We learned the steps we need to be specifically careful with. The handling of enzymes while cloning was taught by the experts in the laboratory.
Designing and optimization:
For the optimization of experiments we modified the planned experiment based on the availability of facilities in our lab and whenever faced with failure how to troubleshoot. Guidance was provided by the respective mentors throughout the project. Special thanks to Dr Bhavana for the constant help in web lab experiments.
Biology softwares:
For the cloning experiment and aptamer designing, we got hands on experience of snapgene and pymol for the designing of plasmid with our insert and simulation of FimH and aptamers respectively.
