August 24, 2022
Time: 7:00
Member: Ms. Crissy
What: Aptamer Resuspension
S2.2: GCAGTTGATCCTTTGGATACCCTGG
1. Before open the container, always briefly SPIN DOWN for the first time after delivery to avoid loss of the aptamer pellet. Briefly centrifuge the aptamer tube to ensure the dried aptamer pellet is at the bottom
2. Dissolve the stock aptamers completely to the desired stock concentration with buffers by shaking. Use buffer shown above. The recommended diluent volume is 100ul. The concentration depending on your application and the yield of the resulting product. Resuspend the aptamer pellet in Aptamer Resuspension Buffer using the volume indicated in the Packing Slip that was included in your aptamer shipment. Quickly spin the sample down (>1000 x g for a few seconds)
3. Aliquot and store stock aptamers at -20°C to -70°C until you use it. Make a stock solution and working aliquots which should be thawed relatively infrequently.
4. Before every use, perform Heating & cooling (H&C) step for the PROPER FOLDING of aptamer structure in buffer including 1~5mM MgCl2 2. Please heat aptamers in proper buffer solution at 95 C for 5 min (in PCR machine), and then leave the tubes on the bench for 15 min.
5. Prior to use, dilute the aptamer to 10 - 100x working concentration in buffer shown above. Heat the aptamer solution to 90-95°C for 5 minutes
6. Allow the aptamer solution to cool to room temperature (~15 minutes). Aptamers are conformationally stable for at least one week at room temperature unless the salt or temperature is significantly changed (falls below 0°C or rises above 30°C).
7. The aptamer can now be further diluted into the final working buffer for your specific application, or Application Buffer. Please use 100 mM NaCl, 5 mM MgCl2, pH 7.2 in Tris or Hepes buffer.
August 24, 2022
Time: 8:00-17:00
Member: Kai
Members: Kai, Koharu, Annmarie, Rui, Hana
What: FRET verification through various protocols
diluting aptamer and biomarker solutions to the intended concentrations
test for aptamer-biomarker binding through detecting fluorescence with the 96 wellplate reader
Protocols:
Protocol 1:
1. Follow Resuspend protocol for aptasensor probes.
2. Make sure solution is suspended in correct buffer.
3. Prepare standard biomarker solution of biomarker using phosphate buffer solution, from a range of 0 to 100 nM in 10 nM increments (so 0 nM, 10 nM, 20 nM…).
4. Add biomarker to aptamer solution in a 9:1 ratio in 96-well plate (so for every 9 microliters of biomarker solution, add 1 microliter of aptamer solution). Aptamer solution should be 1000 nM Total volume should be 10 µL. Calculate final concentrations of aptamer and biomarker in solution using M1V1 = M2V2. Record in table.
5. Let incubate for 30 minutes. Remember to label each well with the concentration of biomarkers used.
6. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 627nm, emitted at 660-720. Record in table.
Result: There was no statistical difference between the fluorescence values between wells.
Protocol 2:
1. Follow Resuspend protocol for aptasensor probes.
2. Make sure solution is suspended in correct buffer.
3. Prepare standard biomarker solution of biomarker using phosphate buffer solution, from a range of 0 to 100 nM in 10 nM increments (so 0 nM, 10 nM, 20 nM…).
4. Add biomarker to aptamer solution in a 9:1 ratio in 96-well plate (so for every 90 microliters of biomarker solution, add 10 microliter of aptamer solution). Aptamer solution should be 1000 nM Total volume should be
100 µL. Calculate final concentrations of aptamer and biomarker in solution using M1V1 = M2V2. Record in table.
5. Let incubate for 30 minutes. Remember to label each well with the concentration of biomarkers used.
6. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 627nm, emitted at 660-720. Record in table.
Result: There was no statistical difference between the fluorescence values between wells.
Protocol 3:
1. Follow Resuspend protocol for aptasensor probes.
2. Make sure solution is suspended in correct buffer.
3. Prepare standard biomarker solution of biomarker using phosphate buffer solution, from a range of 0 to 100 nM in 10 nM increments (so 0 nM, 10 nM, 20 nM…).
4. Add biomarker to aptamer solution in a 9:1 ratio in 96-well plate (so for every 180 microliters of biomarker solution, add 20 microliter of aptamer solution). Aptamer solution should be 1000 nM Total volume should be
200 µL. Calculate final concentrations of aptamer and biomarker in solution using M1V1 = M2V2. Record in table.
5. Let incubate for 30 minutes. Remember to label each well with the concentration of biomarkers used.
6. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 627nm, emitted at 660-720. Record in table.
Result: There was no statistical difference between the fluorescence values between wells.
Protocol 4:
1. Add 50µL of aptamer solution at 1000µM into 96 wellplate
2. Add 50µL of biomarker solution at 1000µM into 96 wellplate
3. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 475nm, emitted at 500-550
Result: There was no statistical difference between the fluorescence values between wells.
The first round of tests were unsuccessful. Maybe the fluorescence value that we are detecting is incorrect. Also, it could be an issue with the way we resuspended the aptamers.
August 25, 2022
Time: 7:00
Member: Ms. Crissy
What: Aptamer Resuspension
S2.2: GCAGTTGATCCTTTGGATACCCTGG
1. Before open the container, always briefly SPIN DOWN for the first time after delivery to avoid loss of the aptamer pellet. Briefly centrifuge the aptamer tube to ensure the dried aptamer pellet is at the bottom
2. Dissolve the stock aptamers completely to the desired stock concentration with buffers by shaking. Use buffer shown above. The recommended diluent volume is 100ul. The concentration depending on your application and the yield of the resulting product. Resuspend the aptamer pellet in Aptamer Resuspension Buffer using the volume indicated in the Packing Slip that was included in your aptamer shipment. Quickly spin the sample down (>1000 x g for a few seconds)
3. Aliquot and store stock aptamers at -20°C to -70°C until you use it. Make a stock solution and working aliquots which should be thawed relatively infrequently.
4. Before every use, perform Heating & cooling (H&C) step for the PROPER FOLDING of aptamer structure in buffer including 1~5mM MgCl2 2. Please heat aptamers in proper buffer solution at 95 C for 5 min (in PCR machine), and then leave the tubes on the bench for 15 min.
5. Prior to use, dilute the aptamer to 10 - 100x working concentration in buffer shown above. Heat the aptamer solution to 90-95°C for 5 minutes
6. Allow the aptamer solution to cool to room temperature (~15 minutes). Aptamers are conformationally stable for at least one week at room temperature unless the salt or temperature is significantly changed (falls below 0°C or rises above 30°C).
7. The aptamer can now be further diluted into the final working buffer for your specific application, or Application Buffer. Please use 100 mM NaCl, 5 mM MgCl2, pH 7.2 in Tris or Hepes buffer.
August 25, 2022
Time: 8:00-17:00
Member: Kai
Members: Kai, Koharu, Annmarie, Rui, Hana
What: FRET verification through various protocols, diluting aptamer and biomarker solutions to the intended concentrations
test for aptamer-biomarker binding through detecting fluorescence with the 96 wellplate reader
(We realized yesterday that we forgot to use the buffer used for the aptamer probes to dilute with)
Protocols:
Protocol 5:
1. Follow Resuspend protocol for aptasensor probes.
2. Make sure solution is suspended in correct buffer.
3. Prepare standard biomarker solution of biomarker using aptamer buffer solution, from a range of 0 to 100 nM in 10 nM increments (so 0 nM, 10 nM, 20 nM…).
4. Add biomarker to aptamer solution in a 9:1 ratio in 96-well plate (so for every 90 microliters of biomarker solution, add 10 microliter of aptamer solution). Aptamer solution should be 1000 nM Total volume should be
100 µL. Calculate final concentrations of aptamer and biomarker in solution using M1V1 = M2V2. Record in table.
5. Let incubate for 30 minutes. Remember to label each well with the concentration of biomarkers used.
6. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 627nm, emitted at 660-720. Record in table.
Result: There was no statistical difference between the fluorescence values between wells.
Protocol 6:
1. Follow Resuspend protocol for aptasensor probes.
2. Make sure solution is suspended in correct buffer.
3. Prepare standard biomarker solution of biomarker using aptamer buffer solution, from a range of 0 to 100 nM in 10 nM increments (so 0 nM, 10 nM, 20 nM…).
4. Add biomarker to aptamer solution in a 9:1 ratio in 96-well plate (so for every 90 microliters of biomarker solution, add 10 microliter of aptamer solution). Aptamer solution should be 1000 nM Total volume should be
200 µL. Calculate final concentrations of aptamer and biomarker in solution using M1V1 = M2V2. Record in table.
5. Let incubate for 30 minutes. Remember to label each well with the concentration of biomarkers used.
6. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 627nm, emitted at 660-720. Record in table.
Result: There was no statistical difference between the fluorescence values between wells.
Protocol 7:
1. Add 100µL of aptamer solution at 1000µM into 96 wellplate into each well A1-A12.
2. Add 100µL of biomarker solution at 1000µM into 96 wellplate into well A1
3. Perform serial dilution with 100µL from A1 to A11.
4. Let incubate for 30 minutes.
5. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 627nm, emitted at 660-720. Record in table.
Result: There was no statistical difference between the fluorescence values between wells; however, the fluorescence values were abnormally high when set at a different frequency: excited at 475nm, emitted at 580-640.
Protocol 8:
1. Add 100µL of aptamer solution at 1000µM into 96 wellplate into each well A1-A3.
2. Let incubate for 30 minutes.
3. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 475nm, emitted at 580-640. Record in table.
Result: The fluorescence values were abnormally high when set at this frequency. We believe this to be attributed with the possibility that the manufacturer that we ordered these aptamer probes forgot to have the black hole quencher on one side, therefore, we will reorder the aptamer probes.
September 23, 2022
Time: 15:00-17:00
Member: Kai
Members: Kai, Julia
What: FRET verification through serial dilution
Our reordered aptamers finally came
Diluting aptamer and biomarker solutions to the intended concentrations
Test for aptamer-biomarker binding through detecting fluorescence with the 96 wellplate reader
We realized yesterday that we forgot to use the buffer used for the aptamer probes to dilute with
Protocol:
1. Add 100µL of aptamer solution at 1000µM into 96 wellplate into each well A1-A12.
2. Add 100µL of biomarker solution at 1000µM into 96 wellplate into well A1
3. Perform serial dilution with 100µL from A1 to A11.
4. Let incubate for 30 minutes.
5. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 475nm, emitted at 580-640. Record in table.
Result: Our experiment was successful and we were able to confirm our detection mechanism through FRET, as the fluorescence of our wells followed the concentrations of aptamer-biomarker concentrations. This means that our aptamers successfully bound to our biomarkers, fluorescing.
September 28, 2022
Time: 16:00-17:00
Member: Koharu
Members: Koharu, Shun
What: ELISA Assay
Protocol:
1: Coat 96 plate wells with 100 μl of the appropriate coating antibody, at a concentration between 1-10 μg/ml in coating buffer. Cover the plate and incubate overnight at 4°C
September 29, 2022
Time: 16:00-17:00
Member: Kai
Members: Kai, Shun, JonJon
ELISA Assay
Protocol:
2.Wash the plate 3 times in wash buffer.
3. Coat 96 plate wells with 100 μl of the appropriate coating antibody, at a concentration between 1-10 μg/ml in coating buffer. Cover the plate and incubate overnight at 4°C
3. Perform serial dilution with 100µL from A1 to A11.
October 5, 2022
Time: 10:30-16:30
Member: Annmarie
Members: Annmarie, Kai, Koharu
ELISA Assay
Protocol:
4. Wash the plate 3 times in wash buffer.
5. Add 150 μl of blocking solution to each well. Incubate for 1 hour at 37°C. Wash 4 times in wash buffer.
6. Add 100 μl of samples to the relevant wells. Incubate for 90 minutes at 37°C or overnight at 4°C.
7. Wash 3 times in wash buffer.
8. Add 100 μl of biotin-conjugated detection antibody (appropriately diluted in wash buffer) to each well. Incubate for 1 hour at 37°C. Wash 3 times in wash buffer.
9. Add 100 μl of enzyme-conjugated streptavidin to first well of each row. Serial dilute across. Incubate for 1 hour at 37°C.
10. Wash 3 times in wash buffer.
11. Add 100 μl of the appropriate substrate solution to each well. Incubate at room temperature for 30 minutes.
12. Read absorbance at the appropriate wavelength=600nn and add 50 μl of stop solution. Gently tap plate to ensure thorough mixing. Measure absorbance within 30 minutes using wavelength of 600nm
Result: There was no statistical difference between the fluorescence values between wells.
October 6, 2022
Time: 15:00-16:00
Member: Kai
Members: Kai, Rui, Sara
What: Shelf-llife Test and Specificity Test
Protocol:
1. Add 50 μl of aptamer solution at 1000µM into 96 wellplate into each well B1-B12.
2. Add 50 μl of biomarker solution at 1000µM into 96 wellplate into each well B1-B12.
3. Perform serial dilution with 50µL from B1 to B11.
4. Place under 96 well plate reader and measure fluorescence. Use fluorescence corresponding to the aptamer probe being used: excited at 475nm, emitted at 580-640. Record in table.
Result: There was a statistical difference between the fluorescence values of the varying concentrations of biomarker solutions. This confirms that the aptamer probes still successfully bind to biomarkers and fluoresce after 2 weeks in the refrigerator.
