Overview
During the competition, we spent a lot of time in the lab to examine the functioning of the fusion products we created. Although not all experiments were completed successfully, we managed to prove our concept, as we created a light-controllable phosphate binding protein. Since we were working with different versions of fusion proteins, we carried out nearly all steps and experiments for 2ABH, SOPP3-2ABH and VVD. More detailed information regarding the timing of the experiments, the experiments used and the protocols can be found in the links.
Isolating the pET-28a(+) Vector and Gibson Assembly
We ordered 2ABH as a single gene. We planned to use the Gibson Assembly method to clone it into the transformation vector pET-28a(+). To be able to perform the Gibson Assembly, we needed to amplify the 2ABH gene as well as the pET-28a(+) vector. To gain the vector, we used Escherichia coli BL21 DE3 pET-28a(+) and did the nucleo-spin plasmid purification. The amplification was checked and confirmed with an agarose gel electrophoresis for both genes, as depicted in figure 1.
Figure 1: Agarose gel electrophoresis of the 2ABH gene (1) and pET-28(+) vector (2). A: DNA marker; B: PCR sample 2ABH and pET-28a(+) respectively.
As DNA marker we used the NEB Quick-Load 1 kb Extend DNA Ladder, which was also used for all following agarose gel electrophoreses. For better visualization, we had the brightest spots on the gels colored red by the software.
In figure 1, there are clear bands in columns B at 1 kb and 5 kb, where we expected the genes for the 2ABH gene and pET-28a(+), respectively, indicating successful amplification. To assess the exact concentration and purity of DNA we generated, we used NanoDrop after extracting the DNA from the gel using the NEB Monarch Gel Extraction Kit. The results are presented in table 1.
Table 1: NanoDrop results for concentration and purity of the 2ABH and pET-28a(+) DNA.
| Gene | Concentration [ng/µL] | A260/A280 | A260/A230 |
|---|
| 2ABH | 96.0 | 1.745 | 1.959 |
| pET-28a(+) | 8.4 | 1.787 | 0.697 |
The A260/A280 value indicates the amount of protein contamination, with a value above 1.7 indicating a sufficient purity. The A260/A230 value is an indicator for contamination with other organic and chaotropic substances; the desired value is at 1.7 or above as well.
As shown in table 1, the concentration and purity of 2ABH is sufficient, while the concentration and organic/chaotropic contamination of pET-28a(+) is not satisfactory.
Therefore, 2ABH was stored at -20 °C and the PCR of pET-28a(+) was repeated in six approaches using annealing temperatures of 53 °C to 62 °C. We checked the PCR using another agarose gel electrophoresis. The results are shown in figure 2.
Figure 2: Agarose gel electrophoresis of pET-28a(+) after PCR at different annealing temperatures between 53 °C to 62 °C. A: DNA marker; B-G: Samples of pET-28a(+) after PCR at various annealing temperatures.
Since there was a clear band detectable at 5 kb in every single column, we decided to extract the DNA from all bands in order to maximize our yield. The extracted DNA was then measured for concentration and purity, using NanoDrop as before. Table 2 shows these results.
Table 2: NanoDrop results for concentration and purity of the pET-28a(+) DNA.
| Gene | Concentration [ng/µL] | A260/A280 | A260/A230 |
|---|
| pET-28a(+) | 90.5 | 1.810 | 1.676 |
As evident in table 2, we succeeded in amplifying the pET-28a(+) vector to a sufficient concentration and purity.
Since we now had both our target gene and the vector in a sufficient concentration and purity, we could start with the actual Gibson Assembly, which we performed according to the protocol. To check for success, we performed a colony PCR of the clones and subsequently an agarose gel elctrophoresis (figure 3).
Figure 3: Agarose gel electrophoresis of colony PCR samples. A: DNA marker; B-J: Colony PCR samples of different clones.
The band in column D just above 1 kb indicated a clone carrying the pET-28a(+) vector with the 2ABH gene and therefore a successful Gibson Assembly. The DNA from this clone was purified using the Machery Nagel NucleoSpin Gel and PCR Clean-up Kit and stored for subsequent transformation of the protein expression strain.
Transformation
For the expression we used E. coli BL21 (DE3) gold. Because these cells are not naturally competent, we made them chemically competent following the protocol. For both VVD-CMI and SOPP3-2ABH, we used 10 ng of the plasmid with 100 µL of the competent cells and added 900 µL of LB media. To insert the DNA into the cells, we used a heat shock. After the transformation, we plated the cells and incubated them over night at 37 °C. Unfortunately, there were no cells grown after the first try, which showed that the transformation was not successful. We tried the transformation a second time under the same conditions, but it still did not work.
As a result, we decided to use 50 ng of the plasmid for the transformation, which worked significantly better, as shown in figures 4 and 5. For VVD-CMI, 33 colonies grew on the plate inoculated with 100 µL of the transformant. On the plate inoculated with 50 µL 43 colonies grew. The plate inoculated with the pellet was too densely grown to be counted. For SOPP3-2ABH, only one colony grew on the plate inoculated with the pellet.
Figure 4: E. coli BL21 (DE3) gold containing VVD-CMI on selection medium.
Figure 5: E. coli BL21 (DE3) gold containing SOPP3-2ABH on selection medium.
As can be seen in figures 4 and 5, the colonies looked uneven, and additionally, only a few colonies grew. This is especially true for the SOPP3-2ABH. One possible explanation for the uneven colony morphology is that the plates were too wet before plating the cultures. One reason for the low number of grown colonies could be that the waiting times between single steps were too long. It is also possible that too many cells were damaged during the heat shock, so that they could not regenerate afterwards.
Considering the time, we still decided to test the expression with those colonies. The controls we made looked good. As can be seen in figure 6, 32 colonies grew on the positive control, while no colony grew on the negative control plate. This indicates that we had no contamination and that the transformation worked.
Figure 6: E. coli BL21 (DE3) gold transformation controls. Positive control left, negative control right.
Figure 7: E. coli BL21 (DE3) gold containing 2ABH on selection medium.
QuikChange
To mutate the 2ABH gene and thereby change some amino acids in the protein that potentially alter the binding properties in our favor, we performed a QuikChange according to the protocol. We used the following list of primers shown in table 3.
Table 3: Sequences of the primers used for QuikChange.
| Name | Sequence |
|---|
| Thr 11 forward | GCGCTGGTGCCCACTTTCCCGCACCAGTC |
| Thr 11 reverse | GACTGGTGCGGGAAAGTGGGCACCAGCGC |
| Ser 39 forward | CAGGGTATCGGCCACAGCGGCGGCGTG |
| Ser 39 reverse | CACGCCGCCGCTGTGGCCGATACCCTG |
| Gly 38 forward | CTATCAGGGTATCCACAGCAGCGGCGGCG |
| Gly 38 reverse | CGCCGCCGCTGCTGTGGATACCCTGATAG |
| Asp 57 forward | GATTTTGGCGCAAGTCACGCCCCGCTTAGC |
| Asp 57 reverse | GCTAAGCGGGGCGTGACTTGCGCCAAAATC |
| Thr 142 forward | GCGGATGGGTCAGGTCACAGTTTTGTGTTTACCTCC |
| Thr 142 reverse | GGAGGTAAACACAAAACTGTGACCTGACCCATCCGC |
| Gly 141 forward | CGCGCGGATGGGTCACACACCAGTTTTGTGTTTACCTCC |
| Gly 141 reverse | CACAAAACTGGTGTGTGACCCATCCGCGCGGCGC |
| Ser 140 forward | CGCCGCGCGGATGGGCACGGTACCAGTTTTGTG |
| Ser 140 reverse | CACAAAACTGGTACCGTGCCCATCCGCGCGGCG |
| Arg 136 forward | GCGGTTGTGCGCCACGCGGATGGGTC |
| Arg 136 reverse | GACCCATCCGCGTGGCGCACAACCGC |
For each mutation we wanted to introduce, we used a forward and a reverse primer containing a mutation at the corresponding bases. After performing the QuikChange, we checked the results with another agarose gel electrophoresis, which is shown in figure 8.
Figure 8: Agarose gel electrophoresis of PCR samples from different QuikChange approaches. A: DNA marker; B-I: PCR samples from different QuikChange approaches.
As can be seen in figure 8, the QuikChange did not work since no bands were detectable on the gel.
After consulting with our advisors, we concluded that it would be necessary to redesign our primers in order to repeat the QuikChange with a higher chance of success. Since there was no time left to redesign and order the primers, perform the QuikChange and transform and check for positive mutants, we decided to discard the approach to optimize the PBP. Nevertheless, this could be an interesting entering point for other researchers or iGEM teams as described in our outlook.
Expression and Purification
SOPP3-2ABH
After the transformation of the SOPP3-2ABH construct had been successful, we decided to test the expression of the gene at 37 °C. Since 2ABH is a E. coli native protein, we had the best expectations for this temperature. We performed a SDS-PAGE to verify the expression of SOPP3-2ABH (see figure 9).
Figure 9: SDS-PAGE of expression control of SOPP3-2ABH. A: Size marker; B: SOPP3-2ABH supernatant; C: SOPP3-2ABH pellet.
As shown in figure 9, only indistinct bands are apparent when SOPP3-2ABH is expressed at 37 °C. The construct has a molecular mass of around 55 kDa. There are visible bands in this area of the gel, which indicates the expression of SOPP3-2ABH worked in general, but not very well. Therefore, we decided to change the expression temperature from 37 °C to 30 °C. Performing the expression at this temperature significantly increased the yield of expressed proteins.
For purification, we used Ni-IDA 2000 columns. Since our protein construct was expressed with a $His_{6}-Tag$ fused to it, we eluted the protein with imidazole. To determine the optimal concentration of imidazole for elution, we tested different concentrations of imidazole (figure 10).
Figure 10: SDS-PAGE of the purification of SOPP3-2ABH eluated with different imidazole concentrations. A: Size marker; B: SOPP3-2ABH flow-through; C: SOPP3-2ABH washing step; D: 5 mM inidazole elution; E: 25 mM imidazole elution; F: 50 mM imidazole elution; G: 100 mM imidazole elution; H: 200 mM imidazole elution; I: 300 mM imidazole elution; J: 400 mM imidazole elution; K: 500 mM imidazole elution.
Because proteins were still visible at an imidazole concentration of 500 mM (figure 10, column K), we decided to use 500 mM imidazole for elution of SOPP3-2ABH.
2ABH
The expression of 2ABH was tested after SOPP3-2ABH, so we decided to test the expression at 30 °C, alongside the expression at 37 °C. Because 2ABH is an unmodified and E. coli native protein, we decided to check the purification directly. The comparison between the expression at 30 °C and 37 °C is shown in figure 11.
Figure 11: SDS-PAGE of the purification of 2ABH expressed at 30°C and 37°C, respectively, and eluated with different imidazole concentrations. A: Size marker; B: 2ABH 30°C flow-through; C: 2ABH 30°C 25 mM imidazole elution; D: 2ABH 30°C 100 mM imidazole elution; E: 2ABH 30°C 300 mM imidazole elution; F: 2ABH 30°C 500 mM imidazole elution; G: 2ABH 37°C flow-through; H: 2ABH 37°C 25 mM imidazole elution; I: 2ABH 37°C 100 mM imidazole elution; J: 2ABH 37°C 300 mM imidazole elution; K: 2ABH 37°C 500 mM imidazole elution.
Since the column was heavily overloaded, we lost a large amount of protein in the flow-through. Additionally, we see that very low concentrations of imidazole already detach some of the protein from the column. Without a washing step, this leads to impurities with other proteins. Therefore, we decided to use two columns for a purification of 2ABH. Also, we decided to perform a washing step with Tris-HCl buffer before elution. Because there was still protein visible at an imidazole concentration of 500 mM (figure 11, column F and K), we decided to use 500 mM imidazole for elution of 2ABH. In addition, we decided to use an expression temperature of 37 °C, since the protein yield did not change significantly compared to 30 °C.
VVD-CMI
The expression of VVD-CMI was first tested at 30 °C and 37 °C. Nearly no protein yield could be observed at neither temperature after purification. The results of this purification are shown in figure 12.
Figure 12: 1: SDS-PAGE of the purification of VVD-CMI expressed at 30°C and eluated with different imidazole concentrations. A: Size marker; B: Flow-through; C: Washing step; D: 5 mM imidazole elution; E: VVD-CMI 30°C 25 mM imidazole elution; F: VVD-CMI 30°C 50 mM imidazole elution; G: VVD-CMI 30°C 100 mM imidazole elution. 2: SDS-PAGE of the purification of VVD-CMI expressed at 37°C and eluated with different imidazole concentrations. A: Size marker; B: Flow-through; C: Washing step; D: 5 mM imidazole elution; E: VVD-CMI 37°C 25 mM imidazole elution; F: VVD-CMI 37°C 50 mM imidazole elution; G: VVD-CMI 37°C 100 mM imidazole elution.
Since the subunits of the VVD-CMI construct each have a molecular weight of around 30 kDa, we expected the VVD-CMI band to be between the lower two marker bands that mark molecular weights of 25 kDa and 35 kDa. As there are no clear bands in this area, we assumed that expression and purification did not work for 30 °C or 37 °C. There were bands with higher molecular weights that we could not identify. Therefore, we changed the expression temperature to 20 °C to reduce the resources spent on cell growth. At this temperature, we could observe bands in the range of VVD-CMI. This SDS-PAGE is shown in figure 13.
Figure 13: SDS-PAGE of the purification of VVD-CMI expressed at 20°C and eluated with different imidazole concentrations. A: Size marker; B: Flow-through; C: 25 mM imidazole elution; D: 100 mM imidazole elution; E: 300 mM imidazole elution; F: 500 mM imidazole elution.
Reducing the temperature had a positive impact on the expression of VVD-CMI, but the yields were still very low. After talking to our advisors, we decided to test different media at 18 °C, namely LB medium, TB medium and an autoinduction medium. To give the organism enough time to produce VVD-CMI, we ran the expression for three days. The results are shown in figure 14.
Figure 14: SDS-PAGE of the purification control of VVD-CMI expressed at 18°C in different media. A: Size marker; H: LB medium flow-through; I: LB medium washing step; J: 500 mM imidazole elution; K: TB medium flow-through; L: TB medium washing step; M: 18°C TB medium 500 nm imidazole elution; N: Autioinduction medium.
As shown in column N of figure 14, the use of autoinduction medium leads to the expression of VVD-CMI. After expressing VVD-CMI in autoinduction medium at 18 °C, we purified it using the $His_{6}-Tag$ and Ni-IDA columns. However, we detected only low concentrations of VVD-CMI after purification. At the molecular weight of VVD-CMI only small and unclear bands could be detected. This is shown in figure 15.
Figure 15: SDS-PAGE of the purification of VVD-CMI expressed at 18°C in autoinduction medium. A: Size marker; B: Flow-through; C: Washing step; D: 500 mM imidazole elution.
Additionally, other proteins with different molecular masses could be detected after purification. Due to the advanced time, we could not investigate this problem further. Although we would have liked to optimize the purification, we had to continue with unclear concentrations of VVD-CMI.
Immobilization
Since our proteins were present in 500 mM imidazole after purification, a buffer exchange was performed using an Amicon column. Afterwards, the proteins were present in HEPES buffer and could be immobilized.
For the immobilization of 2ABH and SOPP3-2ABH, we used EziG beads. These are small porous glass beads that can bind the $His_{6}-Tag$ attached to the proteins. There are three different bead types: opal, amber and coral. Depending on the protein, better or worse binding can be observed. To determine which type of bead is most suitable for us, we used Bradford or BCA Assays to determine how much protein the individual bead type can bind (see Experiments). We used a quantity ratio of 10% protein to 90% beads to determine which bead type is best. Therefore, a known protein mass of SOPP3-2ABH (10%) was incubated with a known beads mass (90%) for all three types (see Protocols). After incubation, the protein concentration of the supernatant was measured using the Bradford or BCA Assay. Comparison of the protein concentration of SOPP3-2ABH after incubation showed a decrease of protein for all three types, whereas opal showed the lowest protein concentration. This shows that all three bead types could bind the protein construct SOPP3-2ABH, with opal being able to bind more protein than coral and amber. Therefore, opal was selected to be used for protein binding in the following experiments.
Table 4: EziG beads immobilization capacity for SOPP3-2ABH.
| Bead type | Phosphate concentration before bead binding [µg/mL] | Phosphate concentration after bead binding (averages) [µg/mL] | Percentage of bound protein [%] |
|---|
| amber | 2746.0 | 634.6 | 76.9 |
| coral | 2746.0 | 696.8 | 74.6 |
| opal | 2746.0 | 455.8 | 83.4 |
For better visualization, the protein concentrations in the initial immobilization experiment for SOPP3-2ABH were plotted against the bead type in figure 16.
Figure 16: Average protein concentration of SOPP3-2ABH in the supernatant plotted against the different EziG bead types amber, coral and opal.
The same procedure was done for 2ABH. This time we achieved even higher protein binding for all three bead types (table 5). Even though opal did not achieve the highest protein binding compared to coral and amber, we decided to use opal for the following immobilizations of 2ABH. The binding was very high in all three cases, and this allows us to better compare 2ABH and our protein construct SOPP3-2ABH.
Table 5: EziG beads immobilization capacity for 2ABH.
| Bead type | Phosphate concentration before bead binding [µg/mL] | Phosphate concentration after bead binding (averages) [µg/mL] | Percentage of bound protein [%] |
|---|
| amber | 5919.5 | 182.0 | 96.9 |
| coral | 5919.5 | 143.0 | 97.6 |
| opal | 5919.5 | 300.0 | 94.9 |
For better visualization, the protein concentrations in the initial immobilization experiment for the sole 2ABH were plotted against the bead type in figure 17.
Figure 17: Average protein concentration of 2ABH in the supernatant plotted against the different EziG bead types amber, coral and opal.
Because the immobilization worked well with the used methods for both SOPP3-2ABH and 2ABH, we decided to use the same procedure in the following experiments. We always kept the same ratio of 10% protein mass and 90% bead mass to immobilize our proteins. Therefore, we measured the protein concentration using the BCA Assay each time we immobilized, since we stopped using the Bradford Assay (see Notebook).
Phosphate Binding and Release
After we managed to immobilize our fusion proteins on EziG beads, the next step was to examine the protein binding capabilities of the PBPs and check out, whether the release of phosphate could be achieved by illumination. For this experiment, we used the Phosfinity Assay to measure the phosphate concentration in the supernatant. We used a stock solution with defined concentration of phosphate. Samples of the supernatant above the immobilized beads were taken after 30 minutes of incubation time. After that, the illumination process was performed. Phosphate concentration in the supernatants was measured using the Phosfinity Assay as well. The average values of phosphate concentrations are shown in tables 6-10.
For better visualization, we decided to plot the average values of phosphate concentration against the time of sampling (figures 18-21). In this way, the change in concentrations during the experiment is easier to display.
We first examined the results for the SOPP3-2ABH construct, since this is the most important part of our project.
Table 6: Average phosphate concentration in the supernatant above the SOPP3-2ABH fusion protein immobilized on opal EziG beads. Concentrations were measured using the Phosfinity Assay at specific times of sampling after different illumination times.
| Time of sampling | Phosphate concentration (averages) [µM] |
|---|
| Stock (before phosphate binding) | 285.8 |
| After phosphate binding | 99.3 |
| After 10 min illumination | 221.6 |
| After 30 min illumination | 277.6 |
| After 60 min illumination | 278.1 |
Figure 18: Average phosphate concentration in the supernatant above the SOPP3-2ABH fusion protein immobilized on opal EziG beads. Concentrations were plotted against the times of sampling after different illumination times.
As shown in table 6 and figure 18, the fusion construct SOPP3-2ABH can bind phosphate. Nearly two-thirds of the phosphate present in the stock solution is bound by the immobilized protein construct. After illumination, the activation of the photosensitizer can be observed since the phosphate concentration in the supernatant increases. After 10 minutes of illumination with blue light, 221.6 µM phosphate is present in the supernatant, which marks a 2.23-fold increase. After 30 minutes of illumination, the phosphate concentration is 277.6 µM, which is nearly the initial amount added via the stock solution. After this point, no significant increase in phosphate could be observed in the supernatant after longer illumination times. After 60 minutes of illumination, the phosphate concentration in the supernatant increased by only 0.5 µM to 278.1 µM. Because of that, we concluded that 30 minutes of illumination is enough for SOPP3 to produce sufficient amounts of reactive oxygen species for protein deconstruction. Based on experience, we estimated an error of 10% in all results of the Phosfinity Assay, since many different members of our team performed the assay, the pipettes carry errors and the assay itself carries an error as well.
We used the unmodified 2ABH protein to control the correct functioning of the SOPP3-2ABH construct. Since we used blue-light illumination to trigger the photosensitizer, the effect of blue light on the sole PBP had to be ruled out. Therefore, we performed the same experiments that we had performed with SOPP3-2ABH with the unmodified 2ABH. The results are shown in table 7 and figure 19.
Table 7: Average phosphate concentration in the supernatant above the 2ABH protein immobilized on opal EziG beads. Concentrations were measured using the Phosfinity Assay at specific times of sampling after different illumination times.
| Time of sampling | Phosphate concentration (averages) [µM] |
|---|
| Stock (before phosphate binding) | 285.8 |
| After phosphate binding | 203.2 |
| After 10 min illumination | 220.2 |
| After 20 min illumination | 223.8 |
| After 30 min illumination | 183.5 |
Figure 19: Average phosphate concentration in the supernatant above the sole 2ABH protein immobilized on opal EziG beads. Concentrations were plotted against the times of sampling after different illumination times.
As shown in table 7 and figure 19, 2ABH can bind phosphate. Nearly one-third of the phosphate present in the stock solution was bound to the immobilized PBP. A slight increase in phosphate concentration in the supernatant was observed with illumination, as the concentration increased from 203.2 µM to 220.2 µM. However, since it decreased to 183.5 µM after 30 minutes of illumination, we assume the change of concentrations was due to measurment errors or mishandling of devices. Considering the errors assumed in the same way as for SOPP3-2ABH, this conclusion becomes even more accurate.
To gain a better understanding of the effect of the photosensitizer on the PBP, we compared the results of the Phosfinity Assays for SOPP3-2ABH and 2ABH. The comparison is shown in table 8.
Table 8: Comparison of the average phosphate concentration in the supernatant above the unmodified 2ABH protein and SOPP3-2ABH fusion protein immobilized on opal EziG beads. Concentrations were measured using the Phosfinity Assay at specific times of sampling after different illumination times.
| Time of sampling | SOPP3-2ABH phosphate concentration (averages) [µM] | 2ABH phosphate concentration (averages) [µM] |
|---|
| Stock (before phosphate binding) | 285.8 | 285.8 |
| After phosphate binding | 99.3 | 203.2 |
| After 10 min illumination | 221.6 | 220.2 |
| After 30 min illumination | 277.6 | 183.5 |
As the average values of the phosphate concentration in the supernatant of 2ABH are nearly constant, the increase of the same in the supernatant of SOPP3-2ABH becomes very obvious. While the phosphate concentration for SOPP3-2ABH nearly reaches the concentration of the stock solution, no such trend can be detected for 2ABH alone. This gets even clearer when the averages are plotted next to each other. This had been done in figure 20.
Figure 20: Average phosphate concentration in the supernatant above the sole 2ABH protein (orange) and SOPP3-2ABH fusion protein (blue) immobilized on opal EziG beads. Concentrations were plotted against the times of sampling after different illumination times.
As shown in figure 20, the effect of the photosensitizer could be demonstrated. However, the difference in concentrations after phosphate binding is unexpected. It is not very likely that the addition of the photosensitizer SOPP3, which is in fact a foreign body, increases the phosphate binding capabilities of the PBP. Therefore, we assume that mistakes occurred in calculation or weighing of the amounts of immobilized protein used.
To study the function of our VVD-CMI construct, we had to adapt the structure of our experiment. Since VVD-CMI is activated by blue light, we incubated the construct stored in an Amicon column in phosphate solution with activated blue light. After 30 minutes of illumination, we measured the concentration in the supernatant, which had been pulled through the membrane via centrifugation. After adding HEPES buffer to prevent the tube and the construct from drying out, we kept VVD-CMI in the dark, what causes the VVD subunits to separate and therefore deactivates the CMI. We took samples in the same way as described above every half hour for five hours. Since VVD has a very long darkness reversion time, no increase of phosphate was observed for the first few hours. This is why we decided to compare the phosphate concentration in the supernatant after 30 minutes of illumination with that after five hours in darkness. The results are shown in table 9 and in figure 21.
Table 9: Average phosphate concentration in the supernatant above the VVD-CMI fusion stored in an Amicon column. Concentrations were measured using the Phosfinity Assay at specific times of sampling.
| Time of sampling | Phosphate concentration (averages) [µM] |
|---|
| Stock (before phosphate binding) | 285.8 |
| After 30 min illumination | 218.6 |
| After 3000 min in darkness | 245.0 |
Figure 21: Average phosphate concentration in the supernatant above the VVD-CMI fusion protein stored in an Amicon column. Concentrations were plotted against the times of sampling.
As shown in table 9 and figure 21, the phosphate concentration in the supernatant above VVD-CMI slightly decreases, after it was illuminated with blue light, it decreased from 285.8 µM to 218.6 µM. After the long time in darkness, the phosphate concentration increased again as it reached 245.0 µM. This could be due to the correct functioning of the VVD-CMI construct. However, as you can see in figure 21, the error bars of the averages after 30 minutes of illumination and after 5 hours in darkness overlap. Thus, the differences could be occurring randomly. If we keep in mind that we were able to express the VVD-CMI construct but had troubles purifying it, we cannot identify the reason for the differences 100% correctly. Possible explanations include different concentrations in the Amicon column, pipetting errors or that VVD-CMI works properly, though not very effective due to the faulty purification. In conclusion, we think the construct works as planned, since that is the obvious explanation. But as mentioned earlier, there is no way to prove it without first achieving more constant results in the purification of VVD-CMI.
Polyphosphate
Since phosphate is currently still a very cheap chemical, we decided to convert phosphate into polyphosphates, since this is much more valuable and offers many possible applications. For this purpose, we used the method of Christ and Blank [1]. In this method, Saccharomyces cerevisiae VH2.200, among others, is used to generate yeast extract rich in polyphosphates. Since two of our advisers work in Prof. Blank's lab, they were able to tell us that the cells in the starving medium double their number by a factor of 2-3 and in the feeding medium by a factor of 1.7. Based on these factors, we can already make an initial assessment of whether everything is working during the experiment. We had a factor of 3.16 for approach one and a factor of 2.89 for approach two during the starving medium. These factors are within or only just above the specified value. The cell count in the feeding medium showed a factor of 2.41 for approach one and 2.67 for approach two. These are above the specified factor and indicate that more cell growth occurred in our test run. After extraction of the polyphosphate from the yeast extract, the polyphosphate could be determined in the form of $KPO_{3}$ in the cell dry weight [% (w/w)]. The content was 23.5% for approach one and 22.9% for approach two (table 10). Christ and Blank achieve a polyphosphate content of 28.3% [1] using the same organism. Our experiment showed a higher growth rate in the feeding medium which could mean that the organism used less energy for the production of polyphosphates than for reproduction. At the same time, we changed the volumes used for our test run (see protocol). We kept the volume ratios the same but reduced the volumes to save on media and costs. This change may also have resulted in a slight change in polyphosphate yield. Overall, a yield of about 23% is very high for polyphosphates in yeast extracts. Thus, the method is comparatively inexpensive and easy to implement and has the advantage that a simple S. cerevisiae can be used. For our project, there seems to be a simple way to convert the phosphates we recycle into polyphosphates.
Table 10: Comparison of the polyphosphate content in dry weight [% (w/w)] of the different approaches with the reference value.
| Approach | Polyphosphate (KPO3) content in dry weight [% (w/w)] |
|---|
| Approach 1 | 23.5 |
| Approach 2 | 22.9 |
| Reference value | 28.3 |
