Improvement of Parts

The original part that we have improved this year is a Dsup protein from the Tardigrade Species Ramazzottius Varieornatus, found in the iGEM registry as part: BBa_K2195000. This protein protects tardigrades by mitigating their damage from X-ray or UV radiation. The flexible Dsup protein binds to genomic DNA by changing its morphology in order to perform the corresponding protective function. We hope to enhance the protective ability of Dsup protein by changing one or a few amino acids.

First, we used the software Hptspot Wizard to look for possible mutant loci and obtained the results shown below.

fig.1 the mutation hotspot displayed by the software hotspot wizard.

And then, we selected two of the possible mutation sites, namely the valine residue at position 195 and the lysine residue at position 198, and tested whether the Dsup protein itself became more stable after mutation by enumeration for all 361 possible double mutation cases using the software DynaMut2. The results of the software analysis are shown in the following table (only the results that became more stable after double mutation are listed in the table for demonstration).

table.1 Dynamut2 Validated Mutation Loci.

Finally, we used the software Hdock for the better-performing double mutations in the above table, and performed a comparison with computer-generated random fragments of DNA at a given GC content.
GAGACCATGATGAGACGTGCCAAGAAGGGACTGAGACTGCCATGCGGGTTTTCAACCGCTTCCTATGACTAATGCATCGGTGAGTACAATGAGATGCAGCAAACCTGCACATTACAAGGGGGGCTATGTTTTCAGGGCCCCGTGTGATCGAGAGGCTTTAAGATAATCACGTCGGAGCGATATCCCGCTGACACCGGCTTGGATACAACAGAGCTGGGGTCACTAGTTGATCACTCCGCGACGTGTAGGGTTCGTAGAGCCGAGATGAACTAGGGAAGTTTTACTCGGTTGAGCCGGGGGTACGTCACCCCCGTTACCACCTTAGGGTTTTATTTGCCTTTGCCAAGAACCTCCCGTGGGAGCGTTGCACTAAGGAAGCCGTAGTGTTGGCTTGGATGTTAGCGCTGCCAGACTAGGACAGCACGTCAAGCAGTGCGTCGTAGCGATAACG
Docking simulations were performed and the results are shown in the following table：

table.2 the Validation of Directional Evolution

We chose the double mutation with better docking fraction and energy drop as the improved result obtained by our directed evolution.
Improved part：

Unfortunately, due to the recurrent epidemic in Shanghai, we did not have time to finished the validation work for our directed evolution by Wet lab, and only obtained the above results with the help of software. Later, we will contonuing verifing our double mutated results through convincing Wet lab. Please go Results to see what we've already done!