Dextran Module: Reducing Syrup Waste by Repurposing Ropy Syrup into Dextran Hydrogels For Agricultural Use

Background

Experimental Design and Results

DexYG Assembly and Cloning

Dextransucrases are natively expressed only in lactic acid bacteria, most notably L. mesenteroides. The numerous variations of dextransucrases are categorized based on the weight of dextran they produce, the types of branching ɑ-linkages, and the strain of lactic acid bacteria in which they are natively found [5]. For this project, we chose to work with a dextransucrase encoded by a smaller gene for ease of assembly. The chosen dextransucrase is known as DexYG, encoded by the dexYG gene found in L. mesenteroides NRRL B-512F [7]. The 4,584 bp gene encodes a 1,527 aa protein that has a molecular weight of 170 kDa [7]. This enzyme is secreted by the host cell so that it can synthesize extracellular dextran when in a sucrose-rich environment.
The DexYG biobrick (composite part BBa_K4130013) created by Team Saptasense was designed for constitutive, extracellular expression of the DexYG enzyme by transformed E. coli. The part contains a strong viral T7 promoter (part BBa_I712074) and ribosomal binding site (part BBa_B0034) for increased expression in vivo. The DexYG gene was optimized for translation in E. coli and contains a double transcription terminator sequence (part BBa_B0015).
Due to its relatively large size, the dexYG gene was purchased in two parts, dexYG1 and dexYG2, of equal length. To facilitate successful ligation, the fragments were PCR amplified using overlapping primers. The final fragments contained >20 bp 5’ and 3’ overhangs, respectively, that were complementary to one another. Additionally, overlapping primers were used to create overhangs on each fragment complementary to the linear pSB1C3 vector. To assemble the plasmid, we used the NEBuilder® HiFi DNA Assembly Cloning Kit from New England Biolabs. Similarly to a Gibson assembly, the NEBuilder® HiFi is able to assemble multiple fragments of DNA together with high efficiency given that the fragments contain overlaps that are complementary to one another. Once the assembly reaction was complete, we confirmed that our DexYG plasmid was completely assembled using gel electrophoresis. Transformation of E. coli was done using chemically competent DH5-ɑ from New England Biolabs.
The DexYG biobrick was successfully ligated to the linear vector to form a fully assembled plasmid, as confirmed by gel electrophoresis (Fig. 2). Transformation of the plasmid into E. coli could not be completed due to time constraints; however, ropy syrup samples were acquired and used as the media from which dextran was isolated. Through this ropy syrup experimentation, we are able to show how the dextran, once produced by the recombinant bacteria, can be utilized for the creation of hydrogels.

Isolating Dextran from Ropy Syrup

Dextran is classified as a homo-exopolysaccharide; that is, it is a long saccharide chain of glucose monomers that is synthesized extracellularly by lactic acid bacteria. Therefore, it can easily be purified from a culture using common exopolysaccharide isolation procedures. These procedures involve numerous days of precipitation and centrifugation followed by purification by dialysis and size-exclusion chromatography. To isolate dextran from our cell cultures and ropy syrup alike, we first added 95% ethanol following brief centrifugation at 12,000 x g before allowing the samples to precipitate overnight at 4℃. The samples were centrifuged at 12,000 x g to produce our polysaccharide pellet, which was redissolved in water before undergoing a second ethanol precipitation step. The final pellet was redissolved in water and underwent a 24 hour dialysis. We used dialysis tubing with a 3,500 Da molecular weight cut off to remove smaller molecular weight saccharides from the dextran. The retentate was dried slowly in an oven for 12 hours to isolate the dextran product.

50 mL of ropy syrup was used during this isolation protocol. 3.2 mg of dried product was isolated from the dialyzed retentate (Figure 4). If we apply this isolation protocol to a full gallon (3.78 L) of ropy syrup, then we would expect to isolate 64 mg of dextran. Given that over 500 barrels of ropy maple syrup have been produced per year in Canada alone since 2014 [9], and each barrel can hold 30-45 gallons (CDL Sugaring Equipment, St. Albans, VT, USA), then, at a minimum, 960 g of dextran can be isolated from ropy maple syrup per year in Canada. If recombinant DexYG E. coli were to be incubated in the syrup to upregulate the production of dextran, then the amount of dextran that can be isolated from the ropy syrup would significantly increase. This shows that there is great potential in harnessing the defected ropy syrup as an alternative substrate for the isolation of large quantities of dextran.

Creating Dextran Hydrogels

The synthesized dextran will be used to create hydrogels for use with seed germination in the agricultural industry. A hydrogel is a crosslinked hydrophilic polymer that is highly absorbent, maintains structure, and doesn’t dissolve in water. Unfortunately, the high production cost limits the advantages of hydrogels. Therefore, our aim was to produce hydrogels by crosslinking dextran isolated from the ropy syrup with the least number of crosslinkers (less reagents thus cheaper), to make affordable and efficient hydrogels. We have chosen N,N′-methylenebisacrylamide (MBAm) as our hydrogel crosslinker. MBAm has been previously used as a crosslinker in dextran-based hydrogels [6] and has been shown to be a safe and effective crosslinker in the creation of hydrogels specifically for agricultural purposes [7].
To create these hydrogels, solutions of 10% (w/v) and 20% (w/v) dextran were created by dissolving dextran in 2.8M NaOH solution. Varying percentages (w/w) of MBAm were added to each solution to create unique hydrogels of various dextran and MBAm compositions. These gels were allowed to solidify overnight at 25℃ before swelling in deionized water at room temperature for 24 hrs. The mass of water absorbed by the gels was measured after the swelling period. Various assays were performed on the swelled gels to characterize their ability to successfully retain and carry water and nutrients to growing plants. These assays included a swelling test in solutions of various pH values to simulate different chemical compositions in soil and a diffusion test to determine how gel pore size created through MBAm crosslinking affected how well nutrients could travel through the gel.
Our first five hydrogels were made with 20% (w/v) dextran and 40%, 50%, 60%, 70%, 80% (w/w) MBAm crosslinker, respectively, which is consistent with hydrogels made in previous literature [8]. While the gels did form and held the shape of the disc in which they were formed, structurally they were hard (not gel-like), brittle, and more translucent-opaque rather than transparent. This structure and formation of gels can be reasoned by the overabundance of crosslinker, producing a brittle hydrogel (Fig. 5).

After initial results of the hydrogels, we decided to remake three 20% dextran gels using the following decreased w/w crosslinker amounts: 10%, 20%, and 30% MBAm, respectively. The second set of gels appeared to be more gel-like as they were transparent, held their shape, and were not as brittle as the initial gels with higher concentration of crosslinkers, therefore the decreased amounts of MBAm were qualitatively better forming hydrogels (Figure. 6A).

Following the crosslinking, the hydrogels were immersed in water for overnight bath to get rid of the excess MBAm that didn’t crosslink with dextran. After the overnight water bath, the three gels plus a 0% MBAm control gel were massed to find their water absorbance capacity. All three gels showed very similar water absorption capabilities as they retained water ranging from 2.66 g to 2.84 g (Fig. 7). The water absorption capacity is one of the most essential properties of a hydrogel as it characterizes the holding capacity of the gel and thus predicts its uses. Therefore, based on the water holding capacity we chose to move forward with our hydrogel assays using 20% dextran and 10% MBAm. The water absorption difference between the highest crosslinker concentration (30%) and the lowest MBAm concentration (10%) was calculated as 7.41%. This difference compared to the overall cost of production between the two hydrogels convinced us that the 10% crosslinking agent was much better for the dextran hydrogels for two reasons: one that it would reduce the amount of MBAm used per hydrogel, therefore reducing cost, and two the lesser mass of chemical crosslinker, the more organic is the hydrogel. Therefore, the 20% dextran and 10% MBAm was identified as the better composition that was keeping the gels simple while still delivering a relatively large amount of water to seeds and seedlings.
After observing the effects of various concentrations of the cross-linking agent, we were curious to observe the effect of varying concentrations of dextran in producing hydrogels. Thus, our next steps included making hydrogels using 10% dextran. We primarily chose 10%, as our overall goal was to create the best characteristic hydrogel (water holding capacity, pore size, pH stability, and diffusion) at the cheapest price and thus with the least amount of the reactants. To test this, three gels were created using 5%, 10%, and 20% MBAm crosslinker. Similarly to the successful 20% gels, the 10% dextran gels formed with a gel-like structure, transparent-translucent in composition, and held their structure when turned upside down (Fig. 6B, 6C). All of these properties, therefore, initially suggested that a 10% dextran hydrogel is able to form a gel very similar to a 20% dextran hydrogel. The 10% hydrogels were then quantitatively tested for their properties by immersing them in an overnight incubation of water to get rid of excess MBAm and to measure the water holding capacity post the incubation period. Following the overnight incubation, the three gels plus a 0% MBAm control were massed to calculate water absorbance. The 10% dextran with 20% MBAm showed the greatest absorbance of water (1.95 g) compared to the other 10% dextran gels (Fig. 7).

This mass of absorbed water is comparable to 2.66 g absorbed by the previously chosen 20% dextran with 10% MBAm gel. For this reason, we chose to move forward with our assays using 20% MBAm crosslinker in our 10% dextran gels.

pH Swelling Assay

This assay was performed to determine the swelling capabilities of the hydrogels in different environments. Solutions of various pH values were used to simulate the diverse chemical compositions of soil. The four pH values were chosen to represent a wide variety of soil conditions without being too acidic or basic, which is not viable for plant growth. The swelling ratios of the 10% and 20% MBAm gels remained similar across all four solution pH values tested (Fig. 8). For pH 2.5, pH 5.5, and pH 7, the 20% MBAm gel swelled more than the 10% MBAm gel; the opposite observation was made for pH 8.5. For all four solution pH values, the 30% MBAm gel had the highest swelling ratio and therefore increased retention of the aqueous solution. The pH 7 swelling parallels the previous absorption data collected for the 20% dextran + 30% MBAm gel (Fig. 7), except in the previous assay, the water absorption for all three 20% dextran gels was similar. A likely cause of the discrepancy is that the pH swelling assay allowed only 3 hours of soaking compared to the 12 hours in the absorption assay. Further replicates of both assays would need to be performed to determine the swelling ratio of a 20% dextran + 30% MBAm gel in pH 7 solution. Ultimately, the data shows that the 10% and 20% dextran hydrogels are capable of absorbing a consistent amount of water across a wide range of pH values, and suggests that the gels are able to be implemented into agricultural work in diverse environments.

Hydrogel Pore Density and Size

For structurally analyzing the hydrogels, we observed the pore sizes and pore density using microscopy. The pore sizes and density provide information on the rate of diffusion. The larger the pore sizes with closer proximity, the faster the rate of diffusion. The rate of diffusion determines the rate of which water and nutrients would travel through the hydrogel, which is an essential characteristic of the hydrogel and its use in enhancing maple seed germination. Small samples of the 20% dextran + 10% MBAm and 10% dextran + 20% MBAm gels were imaged at 10X magnification to characterize their respective pore sizes and calculate the average number of pores in a specified area. The 10% dextran gel (Fig. 9A) showed an increased pore density compared to the 20% dextran gel (Fig. 9C).

In addition, the pores in the 10% dextran gel have an average pore width larger than that in the 20% dextran gel (Fig. 10).

Because the 20% dextran gel maintained its structural integrity post-swelling compared to the 10% dextran gel (Fig. 11), we decided to create an intermediary 15% dextran gel that would resemble a 20% gel in its structure while also maintaining the increased porosity of a 10% gel.

The cross linker also plays a significant role in determining the structural integrity of the hydrogel, therefore the final 15% dextran gel used an intermediate 15% amount of MBAm crosslinker to provide it with a structure stronger than that of a 10% MBAm crosslinked hydrogel. As predicted by the patterns of a 10% and 20% gel, the 15% dextran hydrogel does show an increase in the pore density compared to the 20% dextran gel, but the average pore diameter remained the same as the 20% gel (Fig. 9B, 10). From these results we can conclude that the concentration of dextran may have an effect on the overall pore density within the gel. Further testing is needed to determine if dextran concentration has a significant impact on the average gel pore diameter. Since the 10% and 20% dextran gels had similar water retention capabilities, it is likely that the differences in pore size and density will have a greater effect on the ability of the gels to deliver this water and other nutrients to the plants.

Diffusion Assay

A diffusion assay was performed on the swelled gels to observe how the gel pore sizes could affect how nutrients travel through the gel to the seeds. For beneficial agricultural application, hydrogels must be able to release what they absorb to the seeds in a controlled manner. Surrounding the plant roots with too many or too few nutrients and water can be detrimental to growth [7]. Application of colored food dye was used to simulate soil nutrients traveling through the swelled gels (Fig. 12). The 10% dextran gel showed the fastest diffusion rate (0.016 mm/sec) whereas the 20% dextran hydrogel has a slower diffusion rate (0.011 mm/sec) (Fig. 13). This is supported by the qualitative pore analysis described above. The 10% dextran gel contains an increased number of large pores compared to the 20% dextran gel; therefore, the dye should be able to travel through it faster. The 15% dextran + 15% MBAm gel was also tested in this assay and showed a diffusion rate of 0.014 mm/sec that is also supported by the pore images (Fig. 13). As FD&C Blue #1 dye is 749.9 g/mol (National Center for Biotechnology Information, PubChem Compound Summary), we can conclude that our hydrogels are capable of rapid diffusion of nutrients of similar molecular weight.

Seed Germination Assay

We performed a germination assay to determine whether seed germination is possible on our gels. Ten chia seeds were placed on 9 g of swollen gel. Two controls were created: one where seeds were grown with just water, and one where the seeds grew on a damp paper towel. 5 mL of additional water was added to all five conditions on each day of growth (Fig. 14). On the third day after addition of the seeds to the conditions, we only observed the germination of one seed on the 10% dextran gel (Fig. 15); germination in the other four conditions was not observed by this day . These results show that germination of seeds is possible using our dextran hydrogels.

Conclusion

References

1. de Medieros Dantas, J.M. et al., Bioethanol Production as an Alternative End for Maple Syrup with Flavor Defects. Fermentation 2022, 8: 58. https:// doi.org/10.3390/fermentation8020058
2. Díaz-Montes, E. Dextran: Sources, Structures, and Properties. Polysaccharides 2021, 2, 554–565. https://doi.org/10.3390/ polysaccharides2030033
3. Miao, K.H.; Guthmiller, K.B. Dextran. National Library of Medicine via StatPearls, 2022. PMID: 32491563
4. Zhang, H., Hu, Y., Zhu, C. et al. Cloning, sequencing and expression of a dextransucrase gene (dexYG) from Leuconostoc mesenteroides. Biotechnol Lett 2008, 30, 1441–1446. https://doi.org/10.1007/s10529-008-9711-8
5. Dols, M.; Remaud-Simeon, M. et al. Characterization of the Different Dextransucrase Activities Excreted in Glucose, Fructose, or Sucrose Medium by Leuconostoc mesenteroides. Appl Environ Microbiol 1998, 64(4), 1298-1302. https://doi.org/10.1128/AEM.64.4.1298-1302.1998
6. Dhanapal, V. et al. Design, synthesis and evaluation of N,N1-methylenebisacrylamide crosslinked smart polymer hydrogel for the controlled release of water and plant nutrients in the agriculture field. Materials Today: Proceedings 2021, 45(2): 2491-2497. https://doi.org/10.1016/j.matpr.2020.11.101
7. Zhang, H. et al. Cloning, sequencing and expression of a dextransucrase gene (dexYG) from Leuconostoc mesenteroides. Biotechnol Lett 2008, 30, 1441–1446. https://doi.org/10.1007/s10529-008-9711-8
8. Imren, D. et al. Synthesis and characterization of dextran hydrogels prepared with chlor- and nitrogen-containing crosslinkers.J. Appl. Polym. Sci., 102: 4213-4221. https://doi.org/10.1002/app.24670
9. Pelletier, M. et al., Ropy Maple syrup. Centre ACER, 2018. https://mapleresearch.org/wp-content/uploads/ropy-maple-syrup-presented-at-the-namsc-tech-sessions-2018.pdf

Sarcosine Module

Background

An increasingly prevalent problem sugarmakers face is the production of off-flavor buddy syrup, a cabbage-tasting syrup created from sap tapped late in the season. According to the U.S. Department of Agriculture, buddy syrup “fails to meet requirements of Grade A syrup” [29] and is therefore deemed unfit for human consumption. This occurs when maple trees near the end of the season and start developing buds. During this period, known as bud break, particular amino acids and amino acid derivatives including sarcosine, methionine, asparagine, choline, lysine, and others increase in concentration [1]. Research suggests that these compounds act as methyl (-CH3) donors and therefore, at rising concentrations, alter the tree's metabolic profile to the point of affecting the flavors of the syrup boiled from sap [2]. Currently, no preventative detection methods for buddy syrup exist, meaning that sugarmakers boil down thousands of gallons of sap, causing up to 10% loss of annual income [3]. To combat this problem, our team has targeted 3 of these small molecular compounds - sarcosine, choline, and asparagine - with unique detection assays for determining each molecule’s presence in sap. By combining detection methodologies for each of these small molecules into one unit, Team Saptasense provides a comprehensive biosensor kit that can test whether or not sap is buddy, and therefore prevent waste caused by the unnecessary production of buddy, inedible syrup.
To target sarcosine, a known buddy flavor-causing compound, our team developed an electrochemical aptasensor. The aptasensor utilizes previously established aptamers, single-stranded DNA (ssDNA) sequences that can fold to form pin-loop structures, that selectively and strongly bind to sarcosine. To precisely detect sarcosine levels in maple sap samples, aptamers are placed on electrodes to exploit the folding “aptasensor” mechanism, which causes a change in electrode resistance upon the aptamer binding its target, sarcosine. This binding event induces a difference in the electrical current that can be detected as a signal by an electrical circuit mechanism, like an Arduino Uno circuit board. Collectively, our aptasensor has 3 different components that contribute to sarcosine detection: the aptamer component, an electrode component, and the electrochemical modification components.

Application to Detection of Buddy Maple Sap

Aptasensor Design Components

Our sarcosine aptasensor has 3 primary components in order to detect sarcosine concentrations in sap. In order to develop an effective and fully operating aptasensor we utilized the following design components:

• Basic Biological Parts: We applied the strong, specific binding properties of our novel BioBricks, BBa_K4130014 and BBa_K4130015, to detect free sarcosine molecules. To learn more about our modified ssDNA aptamers, Sar09-3 and Sar11-5, see the Biological Parts section below.
• Screen Printed Electrodes (SPEs): SPEs are “disposable, low-cost and portable [electrochemical] devices” that are made by screen printing conductive ink materials onto plastic or ceramic [21]. To learn more about Screen Printed Electrodes, the types we used, and how we used them, see our Hardware page
• Electrochemical Modifications: Modifications are critical to refining the detection threshold of our sensor to detect micromolar concentrations of sarcosine. Modifications by materials such as nanoparticles can increase electrode surface area and conductivity, and therefore improve detection sensitivity [21]. See the Method Design Process section below to learn more.
  • Electrochemical methods: In order to detect our target molecule electrochemically, our team utilized cyclic voltammetry (CV) and chronoamperometry, and differential pulse voltammetry (DPV) techniques by means of a potentiostatic instrument that circulates and measures electrical current. See the Method Design Process section below to learn more about how we used our potentiostat, and to learn more about these electrochemistry was used to characterize our aptasensor, see our Hardware Page

Inspired and Expected Mechanism

Based on previous studies, when aptamers are deposited onto an electrode through dropcasting or electrodeposition* and introduced to a target molecule, the aptamer will fold and create steric hindrance that triggers a detectable change in electrical resistance on the electrode [6, 7, 10, 12, 13, 14,18, 25]. These electrodes are often modified with nanocomposite materials to immobilize aptamers to them and to improve their sensitivity. Change in resistance can then be modeled to a detection curve that produces a target-concentration readout. For the purposes of our aptasensor, this range would be between the thresholds of sarcosine in normal sap (low concentration) up to the amount of sarcosine in unusable buddy sap (high sarcosine concentration).

Biological Parts

Two basic biobricks are the primary biological components of this module. They are ssDNA aptamers for free sarcosine with a 3’ and 5’ amine modification, respectively, named Sar09-3 (see part registry [19]: BBa_K4130014) and Sar 11-5 (see part registry [20]: BBa_K4130015). Information about these basic parts, why we chose them, and how they were used for our project can be found below.

What are aptamers? Why did we choose them?

Aptamers are single strands of RNA (ssRNA) or, in our project’s case, DNA (ssDNA) that have selective binding capabilities to target proteins or small molecules [10]. Aptamers take on 3-dimensional structures in order to tightly bind to target molecules. These oligonucleotides can be synthesized in vitro with PCR and selected through a process called Systematic Evolution of Ligands by Exponential Enrichment (SELEX) [11]. Taking into consideration these methods and the efforts of previous iGEM teams [12], we prioritized the design, build, and testing of our composite aptasensor over the time-intensive process of synthesizing and selecting our own aptamers via SELEX. Therefore our team performed intensive research to select existing ssDNA sarcosine aptamer sequences that were then ordered to be synthesized by IDT, which ultimately streamline our experimental design.
A primary goal during the brainstorming and implementation stages of our project was to develop an expansive selection of buddy sap detection methods. We chose to target multiple molecules (sarcosine, choline, and asparagine) via three distinct detection methods. After designing modules for applying enzymatic and whole cell agglutination biosensors, we were inspired by the rapidly developing applications of aptamers in conjunction with electrochemical biosensors [22]. One particular study utilizing aptasensors for detecting tryptophan also drew us toward the usage of screen printed electrodes (SPEs), which you can read more about in the SPEs and Electrode Modification section below [7].

How did we choose our aptamers?

To date there have only been 3 total studies that have developed sarcosine aptamers. One of these studies, however, developed aptamer sequences based on glycine and did not determine a singular optimal aptamer sequence, while also lacking aptamer binding and specificity data [13]. Therefore, we selected two different aptamer sequences from the remaining sarcosine-binding aptamer studies to identify which aptamer would bind better to sarcosine in sap samples. The first study was conducted in 2018 and selected an aptamer with a dissociation constant of 134.8 ± 1.12nM in standard buffer (approx pH 7.5) conditions via a modified affinity chromatography capture-SELEX method, indicating strong binding properties [14]. The secondary structure of this aptamer, which we named Sar11-5 (Fig. 3) has the following sequence, 5’-3’: CTCAGTTCGGGACGACCACGCAAATACGAATAGTGTGAACGCGGGAGTCCCGAA*

The second study, conducted in 2019, discovered a high-specificity aptamer via the GO-SELEX selection method. The selective aptamer indicated even stronger binding than that of the previous study, with a dissociation constant of 0.33 ± 0.05nM, and was developed in urine-like buffer conditions [6]. The secondary structure of this aptamer, which we named Sar09-3 (Fig. 4) has the following sequence, 5’-3’: TAGGGAAGAGAAGGACATATGATGTGCCGCGCTTCCCTTGCCGCTCAAAACAGACCACCCACTTTGACTAGTACATGACCACTTGA*
*Underlined portions indicate the consensus sequences of all developed sarcosine aptamers in the respective aptamer selection studies
Since freshly tapped sap can range between pH 3.9 to pH 7.9 [15], we also wanted to test two different aptamers in order to consider whether the more neutral [14] or acidic [6] selection conditions impacted the binding capabilities of aptamers in sap-like conditions.

Aptamer Modification for Surface Binding Compatibility

In addition to selecting Sar09-3 and Sar11-5 based on binding criteria, we wanted to ensure that our aptamers would be compatible with the desired biosensor design and therefore chose to add an amine modification to their respective sequences. Modifications are desirable for applications like fluorescent dye labeling, increasing detection of aptamer folding, and for attachment to solid surfaces [17].To develop a reliable aptasensor mechanism, the aptamer must be able to properly stick to or immobilize on the electrode [18]. The amine modification ensures that the aptamers covalently bond to functional groups present on screen printed electrodes (SPEs) and the nanomaterials selected to modify and improve SPE performance. Therefore, we engineered Sar09-3 to be synthesized with a 3’ “Amino Modifier” (Fig. 5) and Sar11-5 with a 5’ “Amino Modifier C6” (Fig. 6) [17]. To learn more about how we chose the specific modification locations for our aptamers, see the Sar09-3 and Sar11-5 Part Pages [19, 20].

SPEs and Electrode Modifications

To detect when our aptamer is bound to sarcosine, an electrode such as a screen printed electrode (SPE) is necessary to produce a quantifiable electrochemical signal. We were inspired to develop our sarcosine aptasensor to use SPEs in comparison to more expensive alternatives, similar to a recent tryptophan-aptasensor study [7]. In addition, we applied nano-material electrode modifications to our design as to improve SPE performance. This was similarly inspired by material usage of chitosan, carbon-based and gold-based nano-particles (MCWNTs and AuNPs respectively) that were used in the aforementioned study.

Essential Concepts

We executed electrochemical techniques such as cyclic voltammetry (CV), chronoamperometry, and differential pulse voltammetry to quantitatively characterize aptamers binding to ourSPEs. Brief descriptions of these methods, including how and why they are used, are discussed below.

Cyclic Voltammetry (CV), Chronoamperometry, Differential Pulse Voltammetry (DPV)

Cyclic Voltammetry (CV) is an electrochemical technique that measures current under excess voltage conditions, and can be used to evaluate electrochemical activity and characterize materials. This is done by cycling the potential of a working electrode between two potential ranges. The y-coordinates of the graph will decrease in magnitude and approach the x-axis in the case of increased resistance, and the y-coordinates will increase in magnitude in the case of decreased resistance. For our project, we primarily applied this technique to characterize electrode modifications such as electrochemical reduction and deposition methods.
While this current is cycled through an electrode, the working electrode is immersed in a redox solution. Redox reagents are ionic compounds that, under application of an electrical current, undergo a reduction reaction that unfavorably introduces 1 electron to the compound, which reverts back to an oxidized state. One of these redox reagents, potassium ferricyanide, is commonly used for its ability to reduce to potassium ferrocyanide [31] and is the redox reagent we chose to utilize for our CV purposes. Methylene blue is also a commonly used redox reagent that we chose to employ.
Like CV, chronoamperometry is another electrochemical technique that depends on current and applies a square-wave potential to an electrode under excess voltage conditions. The current of the electrode fluctuates according to the diffusion of an analyte from the bulk solution toward the sensor surface. Similarly, it is run in the presence of a redox solution and can be used to examine the electrochemical activity and stability of electrocatalysts. This method was applied to aptamer binding event measurement rather than electrode characterization.
In addition to CV and chronoamperometry, differential pulse voltammetry, a potentiostatic method was used to offer some additional advantages in which the waveform is a series of pulses increasing over a linear baseline instead of producing square-wave potentials under voltage conditions. DPV is a pulse technique that is designed to minimize background charging currents. The base potential value is chosen and applied to the electrode and is increased with equal increments over a time period, during which the current is immediately measured before the pulse application and the end of the pulse forming a pulse wave by recording the difference between the start and the end of the pulse [32]. DPV is therefore a first derivative of a linear voltammogram in which the formation of a peak is observed for a given redox process. In general, DPV is a more sensitive method than the linear sweep methods (CV) because there is minimization of capacitive current. Therefore, the combination of CV, chronoamperometry, and DPV provides essential information to characterize our SPEs and aptamer binding.

Potentiostat Usage

In order to run analytical electrochemical techniques like those outlined above, a current must be consistently applied. These instruments are called potentiostats (Fig. 6), and more specifically contain multiple internal circuits that can generate, hold out, and measure such potentials and currents. Our team was donated a PalmSens4 Potentiostat in order to run these protocols, seen in the image above [33].

Dropcasting vs Electrodeposition

Dropcasting is the method of depositing a desired material onto a working electrode by means of pipetting it from solution. Though the technique is synonymous with pipetting, dropcasting avoids the direct touching of the electrode to preserve its structural integrity.
Electrodeposition is the method of depositing desired solutions onto a working electrode by means of submerging the working electrode in a solution of the desired material and applying either a static or CV/chronoamperometric current. This usually entails adding a redox reagent into solution to ensure proper electron transfer and material-to-electrode assembly.
Comparatively, dropcasting usually takes longer than electrodeposition to apply materials to the electrode due to the associated drying (and sometimes washing) steps. It is also less consistent due to the increased margin of human error, to include non-homogenous solution dispersion or over or under-covering the electrode surface area.
For the purposes of our project, aptamers were only dropcasted onto already modified electrodes. However, we tested both dropcasting and electrodepositing of our nano-composite materials to determine the most optimal electrode modifications, as seen in our Method Design Process below.

Method Design Process

Once we selected our project and target molecules at the end of the brainstorming stage, we searched to find the most effective manner of binding aptamers while increasing electrode conductivity and sensitivity. In order to optimize our procedure for developing a final, functional aptasensor, we evaluated and designed multiple protocols.

Method 1: Gold Nanoparticles

Table 1.

AuNPs on carbon SPEs
Why this protocol?	The article this protocol was based on inspired our team’s initial development of SPE modification processes, which remained constant throughout the project until our final prototype development [7].
SPE Type	Modification Materials	Pros	Cons
Carbon	Gold Nanoparticles (AuNPs)	Increases sensitivity, thiol binding properties ideal for aptamer immobilization	Requires HAuCL4, a hazardous and expensive reagent
	Multi Walled Carbon Nanotubes (MWCNTs)	Increases electrode conductivity as well as surface area on the WE	Expensive reagent making consumer accessibility non-feasible
	Chitosan	Maintains film-formation properties ideal for aptamer adhesion and NP layer assembly	Difficult to disperse in solution for WE deposition

Results

After eliminating MWCNTs due to cost and replacing them with BSA, we chose not to use this protocol due to the price and hazardous nature of the AuNP synthesizing reagent, HAuCl4. Therefore this method did not reach the experimental stage. Because of this method, however, we wanted to continue using chitosan and rGO.

Method 2: Chemical rGO + Chitosan

Chitosan, as seen above, is an amino-polysaccharide/biopolymer with high adhesion and film-formation properties shown to increase surface area and provide a hybridization matrix ideal for ionic and covalent binding interactions [23]. In addition, we decided to approach an alternative to MCWNTs, called reduced graphene oxide, for further method iterations. Reduced graphene oxide (rGO), is a 2D sheet of carbon atoms similar to that of graphene, but is derived from graphene oxide (GO) reduction, resulting in some functional group presence. It can be made via chemical, electrochemical, or biochemical reduction, and it is a cheaper alternative to graphene that maintains mechanical and thermal properties, in addition to electrical conductivity [24].

Table 2.

Chemically reduced GO (crGO)/chitosan/GA/aptamer on carbon SPEs
Why this protocol?	After deciding not to use MCWNTs or AuNPs, we looked into Rochester 2021 BioSpire team’s SPE use and additionally found a study that also used chitosan in compound with reduced graphene oxide (rGO) and glutaraldehyde (GA) [25]. Based on that study, we decided to devise a novel protocol using those nano-materials to modify our aptasensor. Ferricyanide was the utilized redox reagent/mediator for this protocol.
SPE Type	Modification Materials	Pros	Cons
Carbon SPEs: Both Zimmer and Peacock [ZP] and DropSens brands.ZP Hyper Value SPEs had significantly less surface area for drop-casting (pipetting) modification reagents/materials, but were significantly cheaper than DropSens at 99 cents per SPE [26]. However, DropSens electrodes (Fig. 9) maintain more surface area as well as cover other sensitive electrode components [27].	Reduced Graphene Oxide	Increases electrode conductivity as well as surface area on the WE, cost-friendly modification	More fragile and lower quality than alternative carbon based NP materials
	Chitosan	See Method 1	See Method 1
	Glutaraldehyde	Effectively crosslinks amine groups to one another, contributing to effective aptamer immobilization	Hazardous reagent that non-selectively crosslinks; aggressively condenses amines with well known medical properties in tissue fixation [28].

Results

This method indicated that electrode modification with crGO increased conductivity of our aptasensor mechanism, which in turn increases electrode sensitivity. After CV was performed (10 cycles at a scan rate of 0.2 V/s) for each of the two conditions on the same SPE, an increase of 0.4 uA (Fig. 8) occurred as indicated by the increase in y-axes between the unmodified (bluish curve) and the crGO modified (greyish curve) electrode. When the aptamers were deposited (1uM solution) a minor increase in resistance of less than 0.1 uA (scan not depicted) occurred as expected, however, after incubating the electrode in multiple target molecule solutions (1uM, 100uM, and 1mM sarcosine to dH2O), there was no change in resistance, indicating either human error in dropcasting, chemical reduction of GO, or deficit in the detection threshold of the aptasensor itself.

Despite dropcasted crGO/chitosan solution increasing carbon SPEs conductivity, the film it formed was very fragile due the grainy and insoluble nature of the crGO. Initially, after reducing 4mg/mL of GO to rGO (Fig. 10), we approached an oven-based drying method that resulted in expected yield losses between 40-80% that created flakes incapable of homogeneous solution dispersion (Fig. 11). We confirmed that our GO was reduced to crGO by analyzing the loss of functional groups via IR spectra on the sample before and after reduction. After multiple trials of chemical reduction and trying different oven-drying conditions, we attempted lyophilization to reduce flake formation, which ultimately produced a powder-like substance that still had difficulties dispersing in solution with chitosan. Homogeneous dispersion is critical to producing reproducible results with equal layers of nanocomposite. However, we continued to utilize a 1% chitosan solution that was made by dissolving chitosan in 2% acetic acid, vortexing and incubating at 37 degrees C until dissolved, and then bringing it up to a pH of 5 using NaOH.
Ultimately, because of the time consuming nature of the synthesis and recovery of rGO, we employed three more protocols that eliminate this time consuming step.
*Tip: When working with rGO or GO you should always use filter tips so as not to stain or clog your pipettes with graphene, which increases the likelihood of contamination.

Method 3: Electrochemical rGO + Chitosan

Because we wanted to continue working with rGO to improve electrode sensitivity, we developed an electrochemical approach in which to reduce GO without the excess equipment and materials that chemical reduction entails.

Table 3.

On-SPE electrochemical reduction of GO, followed by dropcasting chitosan + GA/aptamer (2 steps)
Why this protocol?	By dropcasting water-dispersed GO on the WE, then running the SPE through a CV cycle to reduce the film to rGO, the reduction step is reduced by multiple hours and creates a more refined rGO film. The first method assembles the NP film in 2 steps where electrochemical reduction occurs before dropcasting chitosan. This protocol uses methylene blue as the redox reagent.
SPE Type	Modification Materials	Pros	Cons
Carbon SPEs: Both ZP Hyper Value and DropSens	Reduced Graphene Oxide	See Method 2	See Method 2
	Chitosan	See Method 1	See Method 1
	Glutaraldehyde	See Method 2	See Method 2

Results

This method indicated that the electrochemical reduction of GO to rGO on the electrode significantly increases electrode conductivity, in which the yellow curve indicates that the electrodeposited/reduced rGO SPE produces 0.3 mA more conductivity than the unmodified SPE in the red curve (Fig. 12). Run with the same CV conditions as Method 2, it is clear that this electrodeposition is both more efficient and effective (Fig. 13), resulting in nearly 750x magnitude of conductivity than the modifications done in Method 2 (0.3mA = 300uA, compared to 0.4uA).

To achieve this result, modification entailed the following before preparing aptamer immobilization.

• Cleaning: Each carbon electrode was washed with DI water
• Graphene oxide (GO):
  • approximately 5uL of 2mg/mL GO was dropcasted onto the electrode
  • 24 DPV cycles were ran in MB from 0 to -1.5 at 0.15V/s to electrochemically reduce the GO to rGO. Electrode was rinsed and dried with PBS
• Chitosan solution for DPV:
  • a 1% chitosan solution was created by dissolving chitosan in 2% acetic acid, vortexing and incubating at 37C until dissolved. 5uL was dropcasted onto the electrode and let dry.

Conclusively, this method was applied primarily for characterization purposes, and demonstrates that the electrochemical reduction of GO onto an electrode produces an effective alternative to chemical reduction of the functional groups from GO to convert it into rGO. Despite the lack of aptamer-target, this method was the basis for the innovation of Method 4 seen below, which not only saved multiple hours of protocol time, but also saved on cost and amount of reagents used.

Method 4: Simultaneous Electrodeposition of rGO + Chitosan

To combine these separate modification steps of rGO electrochemical reduction and chitosan electrodeposition, we developed a novel method for applying these modification steps simultaneously.

Table 4.

Novel On-SPE electrochemical reduction of GO in chitosan solution, followed by GA/aptamer (1 step)
Why this protocol?	By dropcasting water-dispersed GO on the WE, then running the SPE through a CV cycle to reduce the film to rGO, the reduction step is reduced by multiple hours and creates a more refined rGO film. In comparison, this method combines the electrochemical reduction with electrodeposition by combining GO/chitosan in solution and running a CV electrodeposition to make the NP film in one step, in comparison to the previous step. We therefore developed a novel modification protocol based on our previous knowledge and application of modification methods. It also utilizes methylene blue.
SPE Type	Modification Materials	Pros	Cons
Carbon SPEs: Both ZP Hyper Value and DropSens	Reduced Graphene Oxide	See Method 2	See Method 2
	Chitosan	See Method 1	See Method 1
	Glutaraldehyde	See Method 2	See Method 2
	Methylene Blue (MB)	It is a larger organic molecule with amino groups allowing gold and aminated aptamer binding. Studies show that incorporating MB with aptasensors increases the magnitude of folding effects [30]	Could potentially oversaturate the sensor readout, bind to other MB molecules in the presence of crosslinker, or oversaturate with aptamers to the point of omitting any signaling of aptamer binding.

Results

Three conditions were run to test aptamer-sarcosine binding (Fig. 14). For context, the y-axis represents the current in µA and the x-axis represents the potential (V) of the DPV trial runs. For all trials, DPV was run for two cycles between 0.0V and 0.8V and used 1X PBS as the redox solution. Two control conditions were run in PBS where 2 trials were chitosan/MB modified gold SPEs (red and dark blue) and 2 trials were control chitosan/MB and aptamer modified gold SPEs (purple and light blue). The other 2 trials were chitosan/MB and aptamer modified gold SPEs (orange and green curve) that were incubated with 100uL of 1M sarcosine solution at room temperature for 15 mins.
After the two tests were run, results show that a significant resistance change of almost 3 uA (orange curve) and 1uA (green curve) for the respective trials occured after contact with the sarcosine solution. This demonstrates that Sar09-3 successfully bound to the target molecule, sarcosine. When compared to the other methods in this module, it has maintained the most positive and significant results, and is therefore established Method as the most successful aptasensor development protocol in this module.
This novel and effective carbon SPE modification was developed by performing 2 new steps. The values for DPV were the same for this modification method as Method 3.

1. GO/Chitosan solution for DPV: 50% of 1% chitosan solution was combined with a 2G/L GO solution (make a final composition of a 0.5% chitosan, 1% acetic acid, 1G/L GO solution)
2. Methylene blue intercalation: 10uL of 20mM Methylene blue was dropped on the dry modified carbon electrode and allowed to rest for 5 minutes before thorough washing with pH 8 Tris HCL buffer.

Further comparative analysis: Raman Spectroscopy

Another way we compared carbon SPE modifications to determine optimal deposition methods was by performing Raman Spectroscopy. Raman Spectroscopy (RS) is an important tool for investigating the unique “chemical fingerprints” of solid and liquid samples. It investigates the vibrational, rotational, and other low-frequency interactions in a molecule, providing characteristic information about the structure and formation of the sample. The principle of Raman, described as the “Raman Shift”, is the change in wavelength of the photon scattered based on the characteristic of the sample’s molecules [34]. Specifically, when our samples were exposed to a light source during RS, the light interacted with the sample molecules and either got absorbed or scattered (Fig. 15). Additionally, RS provides information based on the energy changes experienced by interacting photons, which is a result of the rotational or vibrational energies of a molecule. These energy changes are specific to the Carbon-Carbon chemical bond, and therefore provide information about the unique chemical properties of a molecule. Altogether, the recorded Raman shift and energy changes of our sample provided significant evidence for comparing the methods for reducing graphene oxide and SPE modification.

Method 5: Gold SPEs + Chitosan

Gold SPEs have very high conductivity compared to carbon SPEs; its thiol groups have functional binding properties ideal for immobilizing aptamers and other organic materials. These SPEs are, however, more expensive and are intended to assist product development to approach a more cost effective and therefore commercially desirable sensor. Regardless, we wanted to test whether the quality of the electrode would affect target signal readout and approached methods of applying gold SPEs.

Table 5.

Crosslinking aptamers intercalated with Methylene Blue to chitosan covered gold SPE
Why this protocol? Protocol Link:	Gold SPEs are much more sensitive than carbon SPEs, but are slightly more expensive due to quality. When the aptamer binding event occurs and the aptamer folds, it will be bonded with MB, which allows for the folding event to maintain greater steric hindrance and therefore increase resistance (i.e. greater signal readout) of electric current passing through the electrode. We utilized gold rather than carbon SPEs due to their binding properties to amine groups as well.
SPE Type	Modification Materials	Pros	Cons
Gold SPEs by DropSens.	Methylene Blue (MB)	See Method 4	See Method 4
	Chitosan	See Method 1	See Method 1
	Glutaraldehyde	See Method 2	See Method 2

Results

Three conditions were run to test aptamer-sarcosine binding (Fig. 16). In all data, the y-axis represents the current in µA and the x-axis represents the potential (V) of the DPV trial runs. For all trials, DPV was run for two cycles between 0.0V and 0.8V and used 1X PBS as the redox solution. Depicted above are one experimental and two control conditions where two control trials were chitosan/MB modified gold SPEs (red and dark blue), and two control trials were chitosan/MB and aptamer modified gold SPEs (purple and light blue), and the two experimental trials were chitosan/MB and aptamer modified gold SPEs (orange and green) that were incubated with 100uL of 1M sarcosine solution at room temperature for 15 mins.
After the two tests were run, results showed a significant resistance change of more than 1.5 uA for the orange curve after contact with the sarcosine solution, indicating that the aptamer successfully bound to the target molecule. Generally, the curves are less favorable than that of the results in Method 4, reinforcing Method 4 as the more optimal method for aptamer immobilization in this module. Reasoning for the second test electrode not binding can be attributed to human error with the crosslinking or rinsing steps regarding aptamer immobilization.
For preparing the gold electrodes for this protocol, the below steps were followed.

• Each gold electrode was washed with DI water and cleaned by electrochemical cycling in 0.1M sulfuric acid for 0.6 to 1.6V at scan rate 0.5V/s for 100 scans.
• Chitosan was applied to the electrode by submerging the electrode in the 1% chitosan solution and applying a constant current of 25μA (200 μA/cm2) for 120s
• Electrode was washed with DI water and then soaked in 1M NaOH for 5 minutes.
• MB intercalation (as seen in Method 4)

Preparing Aptamers for Electrode Immobilization

For all aptasensor protocols, the aptamers needed to be in a solution compatible with electrode immobilization. Once the ordered aptamers were received, they were reconstituted in ddH2O and vortexed vigorously for 30 seconds (or until completely mixed) to make a 1M stock solution that was stored in -20oC for future usage. The aptamers were always thawed on ice and were stored in aliquots to prevent excessive freeze-thaw cycles. Regardless of electrode modifications, in order to execute the final step of aptamer immobilization, the WE of the SPE was always submerged in glutaraldehyde, quenched with 1X PBS, then left to completely dry. Once dry the aptamer solution was always dropcasted in volumes no greater than uL, then rinsed again in PBS once dried.

Conclusion and Future Directions

After applying four full cycles of collective protocol research, design, building, and execution, this module ultimately demonstrated that both of our aptamers were able to immobilize on screen printed electrodes(SPEs) modified with innovative nanocomposite materials, as well as showing that our basic Sar09-3 part can definitively detect sarcosine. While developing our sarcosine-specific aptasensor, we also devised a novel protocol that applies groundbreaking SPE modification research to accommodate the goal of achieving a cost-effective prototype. By using carbon SPEs, we offer a competitive alternative to more expensive electrode options on the market, like glassy carbon electrodes and the gold SPEs we tested for our aptasensor use. In addition, comparing the data between our new carbon-based SPE aptasensor to that of our gold aptasensor, the exposure of the same sarcosine concentration to both Method 4 electrodes and Method 5 electrodes revealed that Method 4 yielded a current change (avg. 1.7uA) over two times that in Method 5 (avg. 0.7uA). This suggests that carbon SPEs can achieve the high sensitivity and conductive qualities of more expensive, inaccessible electrode options like gold SPEs. Therefore Method 4 achieved the most significant data suggesting sarcosine binding, making it our team’s most preferred aptasensor development method. To learn more about the success of our aptasensor and how it was developed, please check out our Hardware Page.

Future goals of our project would entail application of more variable and intensive aptamer modification trials to achieve a more expansive characterization of the aptasensor. In addition, a comparison test to evaluate the differences in folding events between the experimentally tested Sar09-3 with that of the theoretical applied basic part, Sar11-5, would further optimize the fidelity of a final aptasensor prototype.

From these results, Team Saptasense introduces an opportunity to establish more inclusive and widely available engineering solutions for marginalized groups. This attributes not only to the local sugarmakers in our region, but to all small local businesses, disabled and indigenous communities, and to many more that we worked with throughout the course of our project.

References

1. N’guyen, Guillaume Quang, et al. “A Systems Biology Approach to Explore the Impact of Maple Tree Dormancy Release on Sap Variation and Maple Syrup Quality.” Nature News, Nature Publishing Group, 2 Oct. 2018, https://www.nature.com/articles/s41598-018-32940-y.
2. Garcia, E Jose, et al. “Metabolomics Reveals Chemical Changes in Acer Saccharum SAP over a Maple Syrup Production Season.” PloS One, Public Library of Science, 20 Aug. 2020, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7444596/.
3. Miller, David. “What Causes Buddy Syrup and What Can Be Done to Prevent It?” Maple Research, Maple Syrup Digest, 1 Mar. 2021, https://mapleresearch.org/pub/buddy0321/.
4. “Sarcosine.” National Center for Biotechnology Information. PubChem Compound Database, U.S. National Library of Medicine, https://pubchem.ncbi.nlm.nih.gov/compound/Sarcosine.
5. Zhu, Guizhi, and Xiaoyuan Chen. “Aptamer-Based Targeted Therapy.” Advanced Drug Delivery Reviews, U.S. National Library of Medicine, Sept. 2018, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6239901/.
6. Özyurt, Canan, et al. “A Highly Sensitive DNA Aptamer-Based Fluorescence Assay for Sarcosine Detection down to Picomolar Levels.” International Journal of Biological Macromolecules, Elsevier, 6 Feb. 2019, https://www.sciencedirect.com/science/article/pii/S0141813018364171?via%3Dihub#bb0175..
7. Hashkavayi, Ayemeh Bagheri, and Jahan Bakhsh Raoof. “Ultrasensitive and Reusable Electrochemical Aptasensor for Detection of Tryptophan Using of [Fe(Bpy)3](p-CH3C6H4SO2)2 as an Electroactive Indicator.” Journal of Pharmaceutical and Biomedical Analysis, Elsevier, 3 Oct. 2018, https://www.sciencedirect.com/science/article/pii/S0731708518318065?via%3Dihub
8. “Sarcosine.” Sarcosine - an Overview | ScienceDirect Topics, https://www.sciencedirect.com/topics/chemistry/sarcosine.
9. “How Maple Syrup Is Made.” How Maple Syrup Is Made - Vermont Maple Sugar Makers, https://vermontmaple.org/how-maple-syrup-is-made.
10. Liu, Ling Sum, et al. “Recent Developments in Aptasensors for Diagnostic Applications.” ACS Applied Materials & Interfaces, vol. 13, no. 8, 2020, pp. 9329–9358., https://doi.org/10.1021/acsami.0c14788.
11. Drabek, Rafal. “Aptamers vs. Antibodies - Antibody Alternatives.” Base Pair Biotechnologies, 19 Jan. 2020, https://www.basepairbio.com/aptamers-vs-antibodies/.
12. “BioSpire: A Diagnostic Microfluidic Device That Detects Sepsis in Sweat.” Team:Rochester/Results, University of Rochester 2021 IGEM, https://2021.igem.org/Team:Rochester/Results#Top.
13. Guedez, Andrea. “Directed Evolution of Synthetic Riboswitches and a Leucyl tRNA Synthetase,” Texas Christian University, Ann Arbor, 2022. ProQuest, https://www.proquest.com/dissertations-theses/directed-evolution-synthetic-riboswitches-leucyl/docview/2663480714/se-2
14. Luo, Yu, et al. “In Vitro Selection of DNA Aptamers for the Development of Fluorescent Aptasensor for Sarcosine Detection.” Sensors and Actuators B: Chemical, Elsevier, 23 Aug. 2018, https://www.sciencedirect.com/science/article/pii/S0925400518315430.
15. Bates, Dewonica. “Monitoring Ph in Reverse Osmosis in the Maple Industry.” Hanna Instruments Blog, Hanna Instruments, 2 Aug. 2022, https://blog.hannainst.com/ph_maple_reverse_osmosis.
16. Platt, Mark, et al. “Analysis of Aptamer Sequence Activity Relationships.” OUP Academic, Oxford University Press, 12 Nov. 2008, https://doi.org/10.1039/b814892a.
17. “Attachment Chemistry / Linkers Modifications.” IDT, https://www.idtdna.com/site/Catalog/Modifications/Category/2.
18. Oberhaus, Franziska V, et al. “Immobilization Techniques for Aptamers on Gold Electrodes for the Electrochemical Detection of Proteins: A Review.” Biosensors, MDPI, 28 Apr. 2020, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7277302/.
19. https://parts.igem.org/Part:BBa_K4130014 (SAR09-3)
20. https://parts.igem.org/Part:BBa_K4130015 (SAR11-5)
21. “Screen-Printed Electrodes.” Encyclopedia, https://encyclopedia.pub/entry/8814.
22. Huang, Jie, et al. “Advances in Aptamer-Based Biomarker Discovery.” Frontiers in Cell and Developmental Biology, Frontiers Media S.A., 16 Mar. 2021, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8007916/.
23. Congur, Gulsah, et al. “Chitosan Modified Graphite Electrodes Developed for Electrochemical Monitoring of Interaction between Daunorubicin and DNA.” Sensing and Bio-Sensing Research, Elsevier, 19 Dec. 2018, https://www.sciencedirect.com/science/article/pii/S221418041830134X.
24. “Reduced Graphene Oxide: An Introduction.” Graphene, https://www.graphene-info.com/reduced-graphene-oxide-introduction.
25. Rezaei, Behzad, et al. “An Ultrasensitive and Selective Electrochemical Aptasensor Based on RGO-Mwcnts/Chitosan/Carbon Quantum Dot for the Detection of Lysozyme.” Biosensors and Bioelectronics, Elsevier, 9 May 2018, https://www.sciencedirect.com/science/article/pii/S0956566318303518.
26. “Hyper Value Screen Printed Electrodes.” Zimmerandpeacock, https://www.zimmerpeacocktech.com/products/electrochemical-sensors/hyper-value-screen-printed-electrodes/.
27. “DropSens Carbon SPEs.” ..:: Metrohm Dropsens ::.. Screen-Printed Electrodes, https://www.dropsens.com/en/screen_printed_electrodes_pag.html.
28. “Crosslinking Applications: Thermo Fisher Scientific - US.” Crosslinking Applications | Thermo Fisher Scientific - US, https://www.thermofisher.com/us/en/home/life-science/protein-biology/protein-biology-learning-center/protein-biology-resource-library/pierce-protein-methods/crosslinking-applications.html.
29. “United States Standards for Grades of Maple Syrup.” USDA, 2 Mar. 2015, https://www.ams.usda.gov/sites/default/files/media/MapleSyrupStandards.pdf.
30. Tang, Chuyue, et al. “Methylene Blue Intercalated Aptamer to Amplify Signals toward Sensitively Electrochemical Detection of Dopamine Released from Living Parkinson's Disease Model Cells.” Sensors and Actuators Reports, Elsevier, 3 Feb. 2022, https://www.sciencedirect.com/science/article/pii/S2666053922000078.
31. “Cyclic Voltammetry At Solid Electrodes .” Https://Www.asdlib.org/, Experiments in Analytical Electrochemistry, https://www.asdlib.org/onlineArticles/elabware/kuwanaEC_lab/PDF-19-Experiment1.pdf.
32. “Differential Pulse Voltammetry.” Differential Pulse Voltammetry - an Overview | ScienceDirect Topics, https://www.sciencedirect.com/topics/chemistry/differential-pulse-voltammetry.
33. “What Is a Potentiostat and How Does It Work?” Pine Research Instrumentation Store, 24 May 2021, https://pineresearch.com/shop/kb/theory/instrumentation/what-potentiostat-does/.
34. https://www.sciencedirect.com/topics/neuroscience/raman-spectroscopy