Project

Contribution

For the first time in the iGEM competition, our team designed six siRNAs that can down-regulate 5α Reductase and six siRNAs that down-regulate the expression of the stress-activated ion channel protein Piezo1. After a series of validation experiments, we screened the most effective siRNAs, 5αR-siRNA-1 (BBa_K4173009) and Piezo1-siRNA-5 (BBa_K4173019). We also designed a plasmid that expresses β-catenin (BBa_K4173021), a protein that enhances the Wnt/β-catenin pathway and thus promotes cell proliferation. And the plasmid was experimentally validated to express the mRNA of β-catenin in vitro. Details can be found in the Results.

For 5αR-siRNA-1 (BBa_K4173009)

On the NCBI web page, we designed the required murine siRNA for 5αR. The followings are our results:

siRNAs for 5αR:

5αR-siRNA-1: AAUGAGUAAAUAAAUGUCCUG

5αR-siRNA-2: AAUAAACCAGGUAAUAGGCUU

5αR-siRNA-3: AACAAAGUGUGAAAAAUGCAA

5αR-siRNA-4: UCAGAAAGAUCACCGCUGAUA

5αR-siRNA-5: UAAACCAGGUAAUAGGCUUGC

5αR-siRNA-6: AAACAAGCCACCUUGUGGGAU

We respectively transfected plasmids of 5αR-siRNA into RM-1. Then we conducted RT-qPCR utilizing total cellular RNA and performed WB using total proteins. Finally, we found that siRNA-5αR-1 was effective and could reduce the expression of 5αR mRNA by nearly 80 percent. This result indicates that our siRNA can successfully knock down the expression of 5αR.

Fig.1 Analysis of the inhibitory effect of different siRNAs on 5αR by RT-qPCR. RM-1 cells were transfected with 5αR-siRNA-expressing plasmids (5αR-siRNA-1,2,3,4,5,6). Total RNA was harvested 30h later. Quantitative RT-PCR was used to analyze relative expression level of 5αR mRNA.

Fig.2 Analysis of the inhibitory effect of different siRNAs on 5αR by WB. RM-1 cells were transfected with 5αR-siRNA-expressing plasmids (5αR-siRNA-1,4,5,6) or empty plasmid (NC). Total protein was harvested 36h later for western blotting with anti-5αR and anti-GAPDH antibodies (equal GAPDH band densities indicate similar protein levels). The grayscale analysis of WB results by ImageJ visualizes relative 5αR protein expression level.

For Piezo1-siRNA-5 (BBa_K4173019)

On the NCBI web page, we designed the required murine siRNA for Piezo1. The followings are our results:

siRNAs for Piezo1:

Piezo1-siRNA-1: UAGAAACAGCAAAUAGACCAG

Piezo1-siRNA-2: AGUAUAGGCAAAUGAGAUGGC

Piezo1-siRNA-3: AUAAAUGGUGUCUGAUAGCAG

Piezo1-siRNA-4: UAUGUCUUCAUCGUCGUCAUC

Piezo1-siRNA-5: UUCAUCGUCGUCAUCAUCGUC

Piezo1-siRNA-6: AUCAUCGUCAUCGUCAUCAUC

We respectively transfected plasmids of Piezo1-siRNA into RM-1. Then we conducted RT-qPCR utilizing total cellular RNA and performed WB using total proteins. Finally, we found that Piezo1-siRNA-5 was the most effective and could reduce the expression of Pizeo1 mRNA by nearly 70 percent. This result indicated that our siRNA can successfully knock down the expression of Piezo1.

Fig.3 Analysis of the inhibitory effect of different siRNAs on Piezo1 by RT-qPCR. RM-1 cells were transfected with Piezo1-siRNA-expressing plasmids (Piezo1-siRNA-1,2,3,4,5,6) or empty plasmid. Total RNA was harvested 30h later. Quantitative RT-PCR was used to analyze relative expression level of Piezo1 mRNA.

Fig.4 Analysis of the inhibitory effect of different siRNAs on Piezo1 by WB. RM-1 cells were transfected with Piezo1-siRNA-expressing plasmids (Piezo1-siRNA-4,5) or empty plasmid (NC). Total protein was harvested 36h later for western blotting with anti-Piezo1 and anti-Tubulin antibodies (equal Tubulin band densities indicate similar protein levels). The grayscale analysis of WB results by ImageJ visualizes relative Piezo1 protein expression level.

For β-catenin-mRNA (BBa_K4173021)

The plasmid pcDNA3.1-box CD mini-β catenin-mCherry was transfected into HEK-293T, and the total cellular RNAs were used for RT-qPCR to verify the expression level of β-catenin mRNA. The result indicated that our plasmid could express β-catenin.

Fig.5 Analysis of relative mRNA-β-catenin expression level by RT-qPCR. HEK-293T was transfected with C/Dbox-mRNA-β-catenin-expressing plasmids (β-catenin) and empty plasmids (NC). Total RNA was harvested 30h later for quantitative RT-PCR to analyze the relative expression level of mRNA-β-catenin.

Contribution

For 5αR-siRNA-1 (BBa_K4173009)

For Piezo1-siRNA-5 (BBa_K4173019)

For β-catenin-mRNA (BBa_K4173021)

Contact Us