A note on our notebook:
Our team split into three groups to distribute work for the summer and fall of 2022, while initially conducting research thorughout the 2021 school year. Each team for the 2022 work is represented by a color given below.
Key
Non-grouped work
Group 1-Maya, Lindsey, Lea, Zani
Group 2-Jordan, Elena, Julia
Group 3-David, Sydney, Natalie
8/11/21: Did all math for rehydrating twist fragments and the first golden gates into amp vectors. Quanitities found on taxol protocol pages. (Example calculations below)
1 pt Amp backbone
2 pt GGPS
4 pt Amp
1 pt TS 1/2
1 pt TS 2/2
Amp backbone concentration: 1643620 g/mol, 60 ng/ul
Glyma GGPPS: 0.88 ul
Yew GGPPS: 1.04 ul
TS no SUMO: 1.12 ul
TS SUMO: 1.36 ul
TS 2/2: 1.08 ul
8/12/21: Rehydrated twist fragements following Taxol protocol, completed first goldengate of genes of interest into the AMP vectors.
Thermocycled goldengate for 1hr.
Plated.
8/13/21: Plates grew a lawn but we picked out colonies and suspended them in LB broth with carb antibiotic.
8/14/21: No e. coli growth in LB overnight broth, so mini-prep was not done.
8/17/21: Nichole and Lea plated TS no SUMO and Gly GGPPS GG1 (golden gate 1) on carb plates.
8/18/21: No growth on Gly. GGPPS and TS no SUMO carb plates.
8/26/21: Golden gate and plate TS * amp and Gly GGPPS with amp, using a new ligase buffer instead of cutsmart buffer.
8/27/21: Plates looked good with both blue and white colonies, though very few blues. white colonies form outter edges of plates taken and put into 5ml LB broth with carb antibiotic and incubated overnight at 37 ℃.
8/28/21: Miniprepped broths- Messed up resuspending TS*(AmpB B-C) cells with P1 buffer and had to throw out. Gly GGPPS (AmpB B-C) mini-prepped well and put into freezer labeled 8/28 Gly Amp MN.
8/30/21: Miniprepped new TS*(AmpB-BC) cells and digested 1 and 2nd minipreps of Gly GGPPS (AmpB B-C) cells.
8/31/21: Miniprepped and digested all TS* (AmpB B-C) cells and digested last miniprep of Gly GGPPS (AmpB B-C) cells. Cut digests ready to be run on gel to ensure accuracy, currently stored in freezer on new taxol pcr tube plate.
9/1/21:
Gel run of TS* (AmpB B-C) and Gly GGPPS (AmpB B-C) digests- strange results. Smeared ladder could be because of TAE reused too many times, weird electrictiy flow, or time gap between running and taking the photo. Cut/uncut samples also ran weirdly; This could be because of any of the above or the digest/mini prep did not go well.
9/7/21: Nano-dropped Gly GGPPS (AmpB) and TS* (AmpB) miniprepes, all had low concentrations of DNA. Pictures attatched. Low concentrations of all minipreps so decided to redo minipreps. New LB broth and plate agar, new Gly GGPPS (AmpB) and TS* (AmpB) colonies put into overnight carb broth.
9/8/21: One gly ggpps broth grew, so that was miniprepped and put into fridge.
9/9/21: New TS* (AmpB BC) golden gate.
9/13/21: Plated new GG of TS* (AmpB BC) into carb plates.
9/14/21: No new growth on carb plates.
9/16/21: Made new plates with some distictions to see if plating is an issue. Each kind of plate will eliminate one factor as an issue. One plate of each kind will be with gly GGPPS (AmpB BC), and one with an amp-resistant cell stock in glycerin. Each plate has approx. 10ul of plate agar. All carb is a new vial of carb just made today using 0.1 g carb powder in 1 ml dH2O.
Plates
- Carb, XGAL and IPTG (2)
- Carb (2)
- XGAL and IPTG (2)
- Blank plates (2)
XGAL - 2ul/ml
IPTG - 10 ul/ml
Carb antibiotic - 1ul/ml
Plates numbered 0 are made with glycerol stock. Plates numbered 1 are made with 8/24 GLY GGPPS.
9/17/21: Plates appeared as expected, with quality growths on carb and carb xgal plates. Will use plate labeled carb/XGAL IPTG 1 (Gly GGPPS +AmpB BC) as mudium for an over night broth after I have more successful plates. Suspected prior issues could have been incorrectly made carb antibiotic or perhaps the broth spreader was too hot.
9/20/21: Plated new GG Yew GGPPS, TS*, TS no*. None grew. I may have used a different ligase or ligase buffer, and one of these may have been off as no colonies grew. Blue colonies did grow with one of the golden gate rxns but no white colonies so it could have been that that GG rxn didn't have BsaI in it.
9/21/21: Redid just the Yew GGPPS/AmpB BC golden gate with a new ligase and ligase buffer. Running out of AmpB BC backbone.
9/23/21: Electroporated 9/21 Yew GGPPS GG, diluted AmpB BC miniprep, and 8/26 TS* (looks like 8/24 on the mini-centrifuge tube). Plated and put into 37*C incubator over night. 8/24 TS* was made wiith the same ligase and ligase buffer as the 8/24 Gly GGPPS GG that grew on the 9/16 plates, so that reaction should have also worked for the TS.
9/24/21: Plates of AmpB BC and Yew GGPPS (AmpB BC) looked good. TS* (AmpB BC) plate had a couple blue colonies with a few white colonies that may or may not be satelittle colonies.
Overnight brothed AmpB BC, Gly GGPPS, Yew GGPPS, TS*.
9/25/21: Broths of AmpB BC, Gly GGPPS, and Yew GGPPS all grew. All miniprepped and stored in freezer. Will have to redo TS and TS* GG's with the new AmpB BC
9/28/21: Ran gel, Nano-drop, made 4 carb plates, 8 chlor plates for next gg rxn.
Ran gel in order of:
First row:
Ladder, Uncut Yew 1, Cut Yew 1, Uncut Yew 2, Cut Yew 2, Uncut Gly 1, Cut Gly 1
Second row:
Uncut Gly 2, Cut Gly 2, Uncut Gly 3, Cut Gly 3, Uncut Amp 1, Cut Amp 1, Uncut Amp 2, Cut Amp 2
Yew in red
Gly in green
Amp backbone in yellow
Nanodrop Results:
AmpB BC 1 - 147.7 ng/ul
AmpB BC 2 - 94.5 ng/ul
Gly 1 - 56.6 ng/ul
Gly 2 - 59.8 ng/ul
Gly 3 - 109.4 ng/ul
Yew 1 - 119.5 ng/ul
Yew 2 - 110.6 ng/ul
Most look decent though concentrtion is a little low for Gly 1 & 2.
Will use AmpB-BC as backbone for GG1 of TS* and TSno* tomorrow. Will plan to use Gly 1 (56.6 ng/ul) and Yew 1 (119.5 ng/ul) to continue on to GG2.
9/29/21: Prep Gly and Yew GGPPS in AmpB BC for sequencing
Golden gate TS* and TSno* with new AmpB BC
Plated onto carb-XGAL plates and placed into incubator overnight.
9/30/21: Both plates grew blue colonies and had white satelite colonies, but those are not good. Threw away plates and redid both TS* and TSno* GG1. Plated on carb-XGAL plates and placed into incubator overnight.
10/1/21: TSNO plates grew a few colonies and one white colony, but TS* did not grow any. I am thinking that the concentration of e.coli in the broth was simply too low since these are much bigger inserts than the GGPPS's and likely just have a lower success rate.
10/5/21: Re-electroporated 9/30 GG1's with 2x as much concentration. 2ul DNA to 48ul neb 10 beta cells.
Did math for Yew 1 and Gly 1 GG2's.
Electroported GG1 Of Yew 1 and Gly 1 with plans to make a glycerol stock of it. Will throw out stock obviously if sanger sequences come back negative.
10/6/21: TSno had at least one colony that looked ok- no growths on TS*- maybe forgot to add something (again).
Did overnight broths for TSno and some for TS* that might work. could not open new plate agar so sadly couldn't do more.
10/7/21: 2 overnight broths for TSno* grew. Miniprepped both.
Made 8 carb/xgal plates.
Electroporated ChlorA BA-DC and ChlorA CA-D, recovered in incubator from 4pm to 5pm, and plated. Plates put into incubator overnight.
Electroprate Amp Gmubi, Amp E-9, and Gly 1, Yew 1.
Plated Gly 1 and Yew 1 in preparation for a glycerol stock. (carb) + figure out terminator and promoter (e-9 and gmubi?) (8 carb plates).
10/8/21: Put into overnight broths ChlorA CA-B, ChlorA BA-DC, Gmubi, E-9, Yew1, Gly1
10/9/21: Made glycerol stocks of all overnight broths and put those into the -80.
Miniprepped ChlorA CA-B, ChlorA BA-DC, Gmubi, E-9.
10/10/21: Digest ChlorA CA-B, ChlorA BA-DC, Gmubi, E-9, TSno* (6 digests). All with PaqcI.
Nanodrop results:
Run on gels
Top Left to Right- Ladder, UC TS1, C TS1, UC TS2, C TS2, UC E9, C E9
Bottom Left to Right: Ladder, UC ChlorA C-AD, C ChlorA C-AD, UC ChlorA BA-DC, C ChlorA BA-DC, UC Gmubi, C Gmubi.
All look ok except for TS1. Want to Sanger sequence TS2 and see if that is correct.
10/12/21: Sanger sequencing-
MN01- Gly1F
MN01- Gly1R
MN03- Yew1F
MN04- Yew1R
Ordered Sanger sequence primers for TSno*
Forward primer top strand 5'-3'
TCTACAACTAGGGAAGCTCGC
reverse primer bottom strand 5'-3'
CCATCAATTTGAACCACACCT
Location of primers on Tsno* found under sequences
10/13/21:Redid sanger sequencing preps of Yew1 and Gly1. Redid GG1 of TS*.
10/19/21: Sanger sequencing reviews. Gly GGPPS is good and ready to move onto next step. Yew GGPPS is still unclear, not enough overlap between the primers because the reverse pirmer only recorded ~500 BP.
Primers came in for the TSno*
TS* plated.
10/20/21: 2 of 4 broths had growth. Miniprepped TS* on CARB/AMP 1 and 2
Ran gel for both TS*
From Left to Right: Ladder, UC TS*1, C TS* 1, UC TS* 1, C TS*2.
10/21/21: Nano-dropped 10/20/21 TS* minipreps. TS*1: 120.5ng/ul. TS*2 33.1ng/ul. Honestly not sure if TS*1 or 2 looks more accurate to the virtual digest but used ts*1 for sanger sequencing.
Sent in for Sanger sequencing:
- TSnoF0 (#2, 43.5ng/ul)
- TsnoF1
- TSnoR1
- TSnoR0
- TS*F0
- TS*F1
- TS*R1
- TS*R0
- Yew1F0
- Yew1R0
10/27/21: Sanger sequencing returned, TSno* looks good, although I'd like to resend the F0 primer in. TS*1 is definitely NOT good, and yew1 still did not return satisfactory BP numbers. Plan. is to replate and reminiprep Yew1 and TSno#2 and TS*# 1 and 2 on carb plates from the miniprep stock.
10/28/21: Made new LB broth.
Yew1 plates looked good, put those into 2 overnight broths. Hopefully they miniprep well so that sanger sequencing can be successful.
TS*2 plate produced both blue and white colonies, replated those onto carb plates to hopefully better isolate the white colonies.
TSno2 plate did not grow at all, I don't think I had enough miniprep in the ependorf to work for the electroporation. Replating TSno from the 9/30 GG (same as TSno2) onto a carb plate. If we can get white colonies off of those, then we can run the gels.
Did GG2 with gly1 (which looked good with the sanger sequencing) and plated into 2 chlor plates.
I'm a fool and just realized I had TS* and TSno plates with colonies already on them, so overnight brothed 2 each of those. Will mini-prep tomorrow if those grow.
10/29/21: Mini-prep yew1 plates and nanodrop.
Evaluate TS*2 and TSno plates, and Gly1GG2 (chlor) plates- if those look good, put them in the fridge to make a broth out of on sunday or monday.
*Saturday, no growth in broths-no miniprep
Plates in fridge-good growths for both sides
11/1/21: Do a digest on Yew1 A & B- Digest looked good for both., Broth 10/29 plates of TS*2 and TSno white cells.
Gly1 GG2 chlor plate left in incubator, no good. Re-electroporate GG of that onto chlor plates.
11/4/21: Only TS* 2 broths grew, miniprepped and nanodropped.
- TS*2 A - 61.9
- TS*@ B
11/5/21: Digest TS*2 A and B with AarI, run on gel. Gel may be correct but ladder is blurry and hard to tell.
4 overnight broths of TSno, at least one should work.
Electroporated and plated new -35 terminator on a chlor plate to develop a stock.
11/6/21: Chlor terminator plate and carb borths both did not grow.
11/8/21: Sent in Yew1B for sequencing.
5 Blank Carb plates in fridge, taped
1 35 Terminator plate in 37 C
11/9/21: Streak old 11/5 TSno plate on new carb plate.
11/10/21: Put colonies from streaked TSno plate into broth overnight.
Yew1B sequence came back and is good.
Waiting for new cuvettes to do goldengates with the new terminator.
11/15/21: Streaked out ChlorA A-DB for use in TS GG.
Made samples for TS*2A
Still waiting for cuvettes
11/16/21: Submitted TS*2A samples for sanger sequencing.
Put into Overnight broth colonies from chlorA A-DB plate.
Redid GG1 with TSno.
11/17/21: TS*2A sanger sequencing is incorrect.
ChlorA A-DB colonies were mini-prepped but had unusally low nanodrop results and gel looked incorrect.
GG1 TSno plated
11/18/21: GG1 TSno colonies grew and so I pulled out three correct looking ones to put into overnight broth.
Repulled colonies from ChlorA A-DB plates to put into broth- hopefully these show up correctly.
Redid Goldengate1 with TS*
Plated -35 terminator plasmids on carb plate- need these to grow up for goldengate 2 reactions.
11/19/21: Miniprepped ChlorA A-DB and TSno colonies.
-35 terminator still did not grow- Simon said it was ok to pull colonies from his plates
11/30/21: Digest, gel, nanodrop chlorA A-DB, and TSno. Both chlors looked good, TSno1 looked good.
- ChlorAA-DB 1 - 62.6
- ChlorAA-DB 2 - 55.7
- TSno 1 - 89.5
- TSno 2 - 39.9
- TSno 3 - 43.1
Put-35 terminator colonies into overnight broth.
Electroporate and plate TS*GG from 11/18
12/1/21: Both TS colonies put into overnight broth.
12/2/21: Plated CRTE gene (0.5 uL DNA)
Broth of:
- TS*
- CRTE-TS
- 35S terminator
Made carb plates. Plated new terminator heatshock protein AtAHP. Made new broths from 11/17 TSno plates.
New golden gate of TS* into AmpB
Only one TSno grew, so miniprepped that.
Made broth for AtAHP plate and 2 new broths for TSno from 11/17 plate.
Electroporated and plated TS*
12/5/21: All broths grew. Miniprepped AtAHP terminator and the 2 TS nos.
TS* grew both blue and white colonies. 3 broths made of this
12/6/21: Only one TS* colony grew, so miniprepped that and set up three new broths from the same 11/5 plate.
Would like to digest and gel everything that we haven't done so yet.
plan is to use the following combos in plants.
- TS-MBP
- TS-MBP / crtE
- TS-MBP / yew GGPPS (cytoplasmic)
- Control plasmid
12/10/21: electroporate and plate onto chlor plates the ggs of crtE, G.max, and T.can ggpps. Miniprepped TDS-MBP and T5alphaOH.
12/11/21: crtE plate looked good, g.max had a weird fungus on it (plate was probably too old), and t.can didn't grow. Will try reelectroporation of failed plates first.
12/19/21: crtE ggpps put into overnight broth, g.max and t.can plates re-electroporated. Tomorrow if I have time I want to digest and nanodrop TDS-MBP, T5alpha-OH, and crte*TDS-MBP, as well at maybe golden gate into chlor backbone.
2/7/22: sanger sequencing came back inconclusive for samples TXS-MBP, crtE-TXS-MBP, and T5alphaOH. alignments can be found on benchling under the corresponding inserts into amp vectors. Our solution is to do next gen sequencing, so samples must be re-miniprepped using water as the elution buffer instead of the qiagen EB buffer. Today, I used 20ul each of glycerol stocks labeled crtE-TXS-MBP 1, TXS-MBP 2, and T5alphaOH 2 as sources of regrowth in 5ml LB broth along with 5ul carb antibiotic and. Tomorrow these will be re-mininprepped with water instead of EB, then nanodropped and prepared for next gen sequencing. Next gen sequencing samples should be 300ng of DNA in 10ml solution.
2/16/22: Next Gen sequencing came back. T5alphaOH 2 has a C additon in the backbone, should still be usable. TXS-MBP has a 2C deletion in the reading frame that was also found in the Sanger Sequencing, so this is not usable. The crtE-TXS-MBP is still being analyzed and we do not have that yet.
Redid golden gate for TXS-MBP into ampB B-C using the A1, A2, and A3 fragments from twist.
2/17/22: Did golden gate into chlorA BA-DC for yew and gyl ggpps following inserts into chlor procedure. Noticed pipettes not drawing up small amounts normally.
Made four chlor plates and 2 amp plates with xgal and iptg.
Plated 2/16 GG for TXS-MBP onto carb plate
2/18/22: No colonies on TXS-MBP plate,Replated from the same GG reaction. Possible that the pipettes not drawing up small amounts correctly could have affected TXS-MBP GG, so redid paying attention that there was liquid for each draw up, which meant ammounts of bsaI and ligase were slightly increased. Plated 2/17 GG reactions of yew ang gly GGPPS onto warmed chlor plates, incubating for an hour in 37*C between electroporation and plating. Plated 2/18 GG for TXS-MBP onto warmed amp plate. All plates put into 37*C overnight to incubate colonies.
2/19/22: Gly Chlor plate grew. Put into 5 ml broth overnight. Discarded other plates, which looked like they had a fungus on them.
2/21/22: Crte-Txs-MBP is good on next gen sequencing. Did goldengate of crtE-Txs-MBP into chlorA A-DB with gmubi and Athsp. Redid goldengate of Yew into ChlorA BA-DC and TXS-MBP into AmpB B-C. Simon suggested that it may be our electrocompetent cells is the reason why we are getting no colonies on some of our plates. Will try doing electroporation with a crap ton of cells, but also redo our stocks on Neb10beta cells to try to get a higher efficiency.
Left gly chor broth too long, so redid the broth.
Made Chlor and amp plates, and a plate with no antibiotics to begin growth of new neb10beta cells. Neb 10 beta cell protocol found in Experiments
2/22/22: Yew and crte-txs plates grew, but crte-txs plate was too crowded to pull a colony from. Scraped some white colonies from this plate onto a new blank chlor plate. 2 colonies put into chlor and broth from the yew plate. Miniprepped gyl chlor broth.
2/23/22: scraped CrtE plate had too many blues, so I rescraped from the original crte-txs chlor plate onto a fresh one, trying harder to get only white colonies
Miniprepped the two yew ggpps broths.
Nanodropped the two gly ggpps in chlorA BA-DC and the 2 yew ggpps in chlorA BA-DC . Results below.
- Gly ggpps 1 - 100.0 ng/ul
- Gly ggpps 2 - 88.9 ng/ul
- Yew ggpps 1 - 130.4 ng/ul
- Yew chlor 2 - 152.6
Started prep of new electrocompetent cells by innoculating 10ml no-anti LB broth with 20ul of the old glycerol stock of neb10beta cells. Made and autoclaved 100ul 10% glycerol, 1L LB, 2L diH2O, 4 centrifuge bottles, and many eppendorfs. Will also need to set aside 2 already-sterile 50ml centrifuge tubes and pipette tips.
2/25/22: LB should have been incubated over night and we didn't do that :(. So, incubate lb overnight and redo 10ml innoculation broth to prep cells tomorrow.
2/26/22: 10:20am innocluated 1L LB with the 10ml/neb 10beta cell grow up.
LB blank
- 1st LB +cell sample at 11:20am- 0.027 a.u.
- 2nd LB+cell sample at 12:20am- 0.1 a.u.
- 3rd LB+cell sample at 1:20pm- 0.202 a.u.
- 4th LB+cell sample at 1:40pm- 0.223 a.u.
- 5th LB+cell sample at 2:00pm- 0.252 a.u.
- 6th LB+cell sample at 2:20pm- 0.285 a.u.
- 7th LB+cell sample at 2:40pm - 0.294 a.u.
- 8th LB+cell sample at 3:00pm- 0.325 a.u.
- 9th LB+cell sample at 3:13pm- 0.344 a.u.
Goldengate of TXS-MBP in amp using correct dilutions and T5alphaOH into chlorA BA-DC
2/27/22: Miniprepped the 2 crte-txs-mbp chlorA A-DB cells.
2/28/22: Plated electroporations of the TXS-MBP onto a carb plate and T5alphaOH onto a chlor plate.
3/1/22: Put txs-mbp into two overnight broths, streaked out T5alphaOH onto a new plate (too crowded to see if there were white colonies), also streaked out GFP chlor ba-d and ca-d
3/2/22: TXS-MBP and T5alphaOH plates bad. GFP colonies put into overnight broth.
3/3/22: Miniprepped GFP overnight broths.
3/7/22: Put into 5ml of broth and 5ul of carb antibiotic, 10ul of AmpB A-D glycerol stock.
3/8/22: Rachel miniprepped AmpB A-D and started the digest on (all in chlor with gmubi and Athsp) Gly 1 and 2, Crte 1 and 2, Yew 1 and 2, and crte-txs 1 (2 was done by Rachel earlier and looked good)
3/9/22: Ran gel of all digests see image below. Nanodropped.
- Chlor B-C Gly 1 - 129.4
- Chlor B-C Gly 2 - 133.7
- Chlor A-B CRTE-TXS 1 - 264.7
- Chlor A-B CRTE-TXS 2 - 377.5
- Chlor GFP B-D - 60.3
- Chlor GFP C-D - 75.2
- AmpB A-D - 69.9
I would like to continue the plasmid building with Chlor B-C Crte ggpps2, Chlor B-C Yew ggpps 2, Chlor B-C Gly ggpps 2, and Chlor A-B Crte-TXS-MBP 1. The next step is to golden gate the Crte-TXS-MBP into AmpB A-D along with GFP B-D.
3/28/22: Gel run on Crte-TXS-MBP-GFP (amp) and TXS-MBP (amp) plasmids.
3/31/22: New LB Agar made and autoclaved. Mondays gel analyzed. TXS-MBP plasmids were digested with the incorrect enzymes so the results are inconclusive. CrtE-TXS-MBP-GFP (Amp) 1 looks ok. 2 does not. Will continues with a golden gates of CrtE-TXS-MBP-GFP 1 into Chlor. Redigested TXS-MBP (amp) with PaqCI. Uncut standards in PCR tubes in freezer above our taxol boxes.
4/16/22: Electrocompetent cell growup day 3 colab
LB innboculated at 9:10am, at 1hr reading OD was 0.726. LB imediately put on ice with a timer set for 20 min.
4/20/22: Transformed and plated the TXS-MBP GG's onto premade Carb plates
4/21/22: No TXS-MBP growth.
5/23/22: Overnight broth of GUS amp to develop our own stock.
5/24/22: Miniprep of Gus overnight broth. Overnight broth of ChlorA BA-D and final kanamycin vector. Nanodrop of Gus miniprep (102.4ng/ul?)
A1: 1138bp = 703251.76 g/mol = 7.11*10-5 nmol/uL; add 1.43 uL
A2: 1143bp = 706341.46 g/mol = 7.079*10-5 nmol/uL; add 1.44 uL
A3: 1470bp = 908407.84 g/mol = 5.504*10-5 nmol/uL; add 1.83 uL
both samples put into thermocycler: start 5:05pm
two pcr tubes where made each containing:
- 6.5 uL h2o 1st
- 1.25 uL ligase
- 2 uL buffer 2nd
- 0.75 uL Bsa1
- 0.83 uL BC plasmid 3rd
- 1.43 uL A1
- 1.44 uL A2
- 1.83 uL A3
two PCRs where made, because the plasmid addittion was not certain in the first tube
the goal of today was using golden gate ligation to get everything incerted into the same plasmid
5/25/22: Miniprep of ChlorA BA-D and final kanamycin vector.
Nanodrop instrument not operating.
Transformation of E. coli with plasmid : charge pushes the DNA into the plasmid?
5/26/22: Nanodrop instrument still not operating correctly.
today we made 6 vials of growing the bacteria
an open flame was lit to limit contamination
5mL of LB broth was added to each vial
followed by 5uL of antibiotic (carb)
then three colonies from each growth plate (6 total) that were at different locations in the plate and isolated where selected for each where wiped with a mictopipet tip that was then added to the growth medium. All vials were left to grow overnight.
5/27/22: Nanodrop instrument fixed and now operating correctly.
Plated Gus in Chlor BA-D GG on 2 plates (No x-gal, so only chlor antibiotic in plate)
- Time constant of 5.4 for electroporation
- Incubated transofrmation for an hour before plating
- 30 mL agar, 30 uL chlor
- Plate 2 had a tear in agar but was semi-fixed and still plated
Not enough amp was added so growth was not sean from yesterdays work
today electroporation was redone with E2 and J2
Plates are made
5/28/22: GUS-Chlor plates did not grow.
5/31/22: Set up an experiement to figure out why our gus-chlor plates did not produce colonies. Electroporated per protocol the Gus-Chlor BAD with gmubi and athsp and also just the chlorA BAD backbone into ecoli cells. One thing we did differently was ensure we were very gently resuspending the e. coli cells after the electroporation. The two electroporations were plated onto chlor agar plates with xgal and IPTG and placed overnight into 37*C.
6/1/22: Neither plate grew colonies. Streaked out Chlor BA-D glycerol stock cells to make sure it wasn't our plates. Electroporated backbone miniprep and ensured no air bubbles in cuvette by knocking it on the table.
6/2/22: Plate still did not grow. Tried electroporating again with with the stable two cells, both the chlor BAD and the Chlor ADB backbones. Also, made new electrocompetent cells.
LB innoculated at 10:50
At 11:50, OD600 = 0.54! moved to next steps. New cells worked.
6/6/22: The stable two cells grew miniprepped chlor ADB but not chlor BAD. so, chlor BAD backbone is bad. restreaked on plate and will grow up, will also try electroporating the Chlor BAD and the kanamycin final vector to see if these got switched up. autoclaved new LB and LB agar.
Electroporated chlor BAD and kan final vector and plated both on chlor and kan plates to see if they grow.
6/7/22: Jordan and Elena preformed amp without out gene to prove we can do the transformation reliably and they both grew.
Continued to transform our own fragments again and plated.
6/8/22: The plates with our fragments did not grow and we think it may be an issuee with our golden gate. Jordan did the golden gate again with the same recipe from 5/24/22.
6/9/22: A golden gate was done to insert the CRTE-TXS-MPB-GFP construct into a camfix final vector with a kan resistance.
6/10/22: The golden gate was transfected into NEB cells and plated on Kan plates.
Plates from Jun 8 golden gate grew.
6/11/22: The plates grew and were put in the fridge.
Selection and grow up of Jun 10th plate .
6/13/22: 2 colonies from the plate were brothed in 5ml of LB with 5uL of Kanamyacin and put in the incubator to grow up overnight.
6/14/22: Digest and run gel
lane 1: 1kb ladder
lane 2: small
lane 3: medium
lane 4: large - proceed and ask Simon (think it is the right target plamis but it traveled a little farther than expecctd (maybe supprcoiling?))
lane 5: ladder
We took three colonies from the past plate and steaked it on a threee new plates to spead out growth
6/15/22: Results from the re-streaking
Grow up done from these plates
6/16/22: mini prep and digest done gel run
lane 1: ladder 1kb
lane 2: colonie 1
lane 3: colonie 2 with uncut conlonie 1
lane 4: uncut colonie 1 (lower concentartion)
lane 5: uncut colonie 2 plasmids expected to be around 5000 but are about 3000
no seam so no suppercoiling effect
6/17/22: New golden gate following 5/24 procedure
6/18/22: Used golden gate enzyme BSAI to ligate two parts of TDS2 sequence from TWIST
(S) redid golden gate, set to 18 hour, used volumes David calculated from white board.
6/20/22: Disabled BsaI and transformed and plated.
6/21/22: Plates did not grow
No growth on plates
6/22/22: Redid golden gate, set to 18 hour, used volumes David calculated from white board.
6/23/22: Redid plates with a control plate
6/24/22: Control plate grew, but golden gate did not
6/25/22: mini prep AMPbcts2
Miniprep AMPbcts2
6/29/22: Prepared overnight growths of Amp B-C TS2
Working on reordering genes from IDT
6/30/22: Purpose: Miniprep to isolate DNA from Amp B-C TS2 E. Coli colonies
Protocol: Followed regular Qiagen miniprep, using centrifuge processing and H2O for the final wash.
Results: Miniprepped! Tubes labeled: AMP B-C TS2 6/30, numbers 1 and 2
Future Directions: Restriction digest using PaqCI to determine if transformation was succesful.
Restriction digest of AmpB-C TS2
Purpose: Determine if cloning was succesful by comparing digest results with expected lengths
Protocol:
- Digest Made with:
- 14 ul H2O
- 2 ul Buffer (10x)
- 3ul DNA
- 0.5ul PaqCI activator
- 0.5ul PaqCI
- Thermocycled at 37C for one hour.
- Samples ran on an agarose gel with 4uL Loading Dye each.
Expected Results: (same for both samples)
Nanodropped AmpB-C TS2 DNA samples:
- TS2 1: 51.9 ng/uL
- TS2 2: 99.1ng/uL
10uL of 40ng/uL (total 400ng of DNA) of each sample was sent off for sequencing.
Golden Gate Construction of Two Constructs, one with our target gene and one with GFP:
-ChlorA-DB Gmubi:TDS2:AtHSP
Purpose: Add promoters and terminators to target genes
Protocol: 2 ChlorA-DB Gmubi:TDS2:AtHSP plasmids will be made, one with TS2 1 and TS2 2, two separate minipreps.
Reaction 1: TS2 1
- Water - 5.53 uL
- Ligase buffer - 2 uL
- ChlorA A-DB - 1.20uL
- Gmubi - 1.80 uL
- AtHSP - 1.35 uL
- TS2 1 - 5.37 uL
- PaqCI - 0.75 uL
- PaqCI activator- 0.75 uL
- Ligase - 1.25 uL
Total volume: 20 uL
Reaction 2: TS2 2
- Water - 8.1 uL
- Ligase buffer - 2μL
- ChlorA A-DB - 1.20uL
- Gmubi- 1.80uL
- AtHSP- 1.35uL
- TS2 2- 2.80uL
- PaqCI -.75μL
- PaqCI activator -.75μL
- Ligase - 1.25μL
Follows normal goldengate procedure as listed in the Experiments page.
Purpose: Create a ChlorB-AD Gmubi:sfGFP:AtHSP plasmid for marking GFP in our plants.
Total Volume: 20 uL
Notes: No GFP stock solution available.
20uL of stock glycerol GFP bacteria were added to 5mL of LB media for overnight growth, to be miniprepped
7/5/22: Restriction digest of AmpB-C TS2 d
Purpose: Determine if cloning was succesful by comparing digest results with expected lengths
Protocol:
Digest Made with:
Expected Results: (same for both samples)
7/7/22: Nanodropped AmpB-C TS2 DNA samples:
10uL of 40ng/uL (total 400ng of DNA) of each sample was sent off for sequencing.
7/8/22: Golden Gate Construction of Two Constructs, one with our target gene and one with GFP:
-ChlorA-DB
Gmubi:TDS2:AtHSP
Purpose: Add promoters and terminators to target genes
Protocol:
2 ChlorA-DB Gmubi:TDS2:AtHSP plasmids will be made, one with TS2 1 and TS2 2, two separate minipreps.
Calculations:
Reaction 1:TS2 1
Total volume: 20μL
Reaction 2: TS2 2
This mixture is then cycled at 37°C for 1 hour, then 65°C for 5 minutes, then rests at a temperature of 4°C.
Notes: No GFP stock solution available.
20uL of stock glycerol GFP bacteria were added to 5mL of LB media for overnight growth, to be miniprepped 7/9
20uL of stcok glycerol gmubi e. coli added to 5mL oif LB for minprep 7/9.
Grown w glycerol stock:
5mL LB
20uL of glycerol stock (dont let melt all the way)
7/9/22:
20uL of stock glycerol gmubi e. coli added to 5mL of LB for minprep.
Grown w/glycerol stock:
75ng of ChlorB-AD and 1:2 molar ratios of Backbone to insert.
Purpose: Transfection of GFP and TS2 plasmids transfected into E. Coli then plated.
Protocol:
Followed Transformation Protocol with most recent TS2 and GFP constructs.
Plates were made using "Making plates and plating" protocol, using Chloramphenocol.
Plates Labeled with their respective genes. I.e.:
Meeting Notes:
We need to make a plasmid with GGPPase (CRTE) and a promoter and terminator.
CRTE should be in lab already, will need to add promoter and terminator.
7/11/22 Sending off mini-prep #1 (conc. 166.9)
final plasmid came back missing sections of a promoter, with mistakes in the GFP and gmubi regions.
Purpose: Create a ChlorB-AD Gmubi:sfGFP:AtHSP plasmid for marking GFP in our plants.
75ng of ChlorB-AD and 1:2 molar ratios of Backbone to insert.
Total Volume: 20uL
7/12/22: Purpose: Transfection of GFP and TS2 plasmids transfected into E. Coli then plated.
Protocol:
Followed Transformation Protocol with most recent TS2 and GFP constructs.
Plates were made using "Making plates and plating" protocol, using Chloramphenocol.
Plates Labeled with their respective genes. I.e.:
Meeting Notes:
We need to make a plasmid with GGPPase (CRTE) and a promoter and terminator.
CRTE should be in lab already, will need to add promoter and terminator.
7/14/22: Sequencing results came back for AmpB-C TS2. both were 100% with full coverage, so only one aliquot will be kept for space's sake.
Redid golden gate reaction from Monday 7/11
Purpose: Create a ChlorB-AD Gmubi:sfGFP:AtHSP plasmid for marking GFP in our plants.
75ng of ChlorB-AD and 1:2 molar ratios of Backbone to insert.
Total Volume: 20uL
7/15/22: Transformation of Gmubi:sfGFP:AtHSP into E. Coli. Following regular transformation protocol.
7/18/22: Did overnight broths with additional colonies of the final plasmid vector, put into 28c incubator overnight.
In order to create a CRTE plasmid, CRTE will be transformed into NEB 10beta cells and plated, to be grown up tomorrow (7/19), following regular transformation and plate making protocol.
7/19/22: Colonies miniprepped.
IDT order arrived with T5AT and TXS (did not have to order them in fragments this time!)
golden gate performed:
T5AT= 1342 bp= 829311.52 g/mol
50 ng/uL / 829311.52 ng/nmol= 6.092 E-5 nmol/uL
R=1.48196
V=3.28
Amp= 1643756.44 ng/nmol
2 * 74.2 ng/uL /1643756.44 ng/nmol= 9.028E-5 nmol/uL needed of each vector
R=1
F=2.21599
V=2.22
TXSMBP1= 1674 bp= 1034467.6 g/mol
50 ng/uL / 1034467.6 ng/nmol= 4.833E-5 nmol/uL
R=1.86799
V=2.09
TXSMBP2= 1808 bp= 1117271.56 g/mol
50 ng/uL / 1117271.56 ng/nmol= 4.475E-5 nmol/uL
R=2.01743
V=2.28
Amp= 1643756.44 ng/nmol
2x*1643756.44 ng/nmol nmol/uL needed of each vector
2 * 74.2 ng/uL /1643756.44 ng/nmol= 9.028E-5 nmol/uL needed of each vector
R=1
4.86633F=5.5
1.13021=F
V=1.13
x/1643756.44 ng/nmol= R * conc
R=X/1643756.44*Conc
RF+RF+F=5.5 uL
CRTE Plasmid transformation was unsuccesful, so transformation protocol will be repeated. Plates were made with Amp.
7/20/22: Transformed and plated golden gate.
CRTE Plate had white plaques, so an overnight growup was prepared by scraping a colony into a conical tube with a pipette tip, with 5mL LB and 5uL of 100mg/uL of CARB antibiotic.
To meet the needs of the lab, we started the procedure to make more electrocompotent cells.
7/21/22: Plates with only white colonies!
Took three colonies from each plate and did a grow up.
7/22/22: Perfomed digests for all 6 grow ups and ran gel.
Gel fell appart when trying to run (think left it sit in the TEA for too long)
lane 1: 1kb ladder
lane 2: TX E1
lane 3: TX E2
lane 4: TX E3
lane 5: T5 E1
lane 6: T5 E2
lane 7: T5 E3
lane 8: 1kb ladder
Gel fell apart and I couldnt get a good enough picture
Completed electrocomptent lab procedure with no noticeable changes, save for not flash freezing the cells with liquid nitrogen before putting them in the freezer.
7/25/22: Re-ran same pcr samples from 7/22
lane 1: 1kb ladder
lane 2: TX E1
lane 3: TX E2
lane 4: TX E3 (good)!
lane 5: T5 E1
lane 6: T5 E2
lane 7: T5 E3 (good)!
lane 8: 1kb ladder
Ran for 35min
Today we will add the CRTE plasmid to a Chlor backbone along with its promoter and terminator, followign normal golden gate protocol using PAqCI.
Calculations:
Total Volume: 20uL
values varified with Dr. DeDecker. GG set to 18 hours
7/26/22: Redid the digest and gel.
7/28/22: Nanodropped TXS3 and T5AT3 and diulted them to be sent in for sequencing.
8/4/22: Miniprep of CRTE Chlor
8/8/22: Digest with BSAI
Used NG 8/4 CRTE tube and "1" gTDS2 7/14 tube
8/12/22: Sequencing came back
CytoTXS-MBP aligned perfectly
T5AT did not align at all
Future steps:
Add Gmubi promoter and At HSP terminator to CytoTXS-MBP
Take colonies from the T5AT July 21 plates to resequnce
8/15/22: Redid CRTE golden gate with ChlorBA-DC backbone:
8/16/22: Transformation
Plate:
Meeting notes:
attatched is a draft of what each part should look like before going into the final vector. also final vector should have opposite antibiotic resistance so anything that is not that final product below will die.
8/17/22: Crte-txs-mbp in the final vector came back again with an incorrect gmubi promoter. We will need to remake the gmubi promoter. Restarted from glycerol stock in an overnight broth.
cytoTXS-MBP golden gate
18 hours GG on Thermocycler
Calculations:
8/18/22: New gmubi in amp stock was miniprepped and has a concentration of 49.21ng/uL. New golden gate reaction of the crte-txs-mbp with this new gmubi.
Miniprep of CRTE from 8/15
CytoTXS MBP golden gate was done with same recipe as 8.17 because Gmubi was said to be bad in 8.17 recipe
8/19/22: 8/18 Golden gate reaction plated onto two chlor plates
8/20/22: Both plates looked good, although it appears chlor was throughly mixed into the agar, either the xgal or iptg was not throughly mixed into the agar, creating an ombre effect across the plate. However, even the paler side of each plate still showed a little blue coloration. three completely white colonies were pulled from the more blue side and but into an overnight broth.
8/21/22: Colonies miniprepped
8/22/22: Nanodropped and ran a gel, looked like there was extra genomic dna in each miniprepp although aside from that samples 1 and 2 looked good, though not fully digested
T5AT grow up done by Julia
8/23/22: T5AT grew up so mini prep was done today and put in freezer labled G2 T5AT EJ MP 8.23
8/24/22: New colonies pulled to miniprep, put in overnight growth
8/25/22: New colonies miniprepped and nanodropped. Nanodrops looked a little wacky.Digested both samples with BSAI and ran a gel.
Ran 2 golden gates of ThalphaOH to pair it with gmubi and AtHSP, one into chlorA BA-DC and one into chlorA CA-D
Electroporating and plating with chlor antibiotic the golden gate of cytoTXS2-MBP from Aug 17th
Future directions: digest and run gel of T5AT
Grow up cytoTXS2-MBP if plate grows
8/26/22: Pulled two new colonies from the gmubi-crteTXSMBP-AtHSP chlor plate and put into overnight broth. Electroporated and plated both t5alphaOH chlor pieces and also one of the gmubi-crteTXSMBP-AtHSP chlor minipreps that looked good except for maybe some genomic dna.
From yesterdays plating of CytoTXS2-MBP
8/30/22: T5AT digest and gel:
- 14.24uL H2O
- 2uL 10x cut smart buffer
- 3uL DNA
- 0.5uL PaqC1
- 0.5uL PaqC1 activator
(thermocycle over night. If crunched for time can put in incubator for 30min-60min then run gel.
Today put in the incubator)
Made gel:
Results looking for:
Used PaqcI, but might need to use BsaI
lane 1: 1kb ladder
lane4: 1kb ladder
lane5: T5AT
Plate from Aug 26 has all blue colonies now
Future directions: Redo elctroporation and make a new plate from the Aug. 18th cytoTXS2-MBP golden gate containing promter and terminator
Grow up of new agro backbone (kana resistance)
Grow up of RUBY marker (from Maya!)
8/31/22: Performed new transformation cytoTXS2-MBP and plate with chlor - labeled 8/31 cyto-TXS2-MBP Chlor G2 EJ
- 15uL of Chlor
- 15 mL of LB
- ***forgot to include Xgal
9/1/22: Redo the T5AT gel so need to do another digest and will let thermocycles overnight to do gel tomorrow
T5AT digest with BsaI
- 14.4uL H2O
- 2uL 10x cutsmart buffer
- 3uL DNA
- 0.5uL BsaI
thermocycle for 1 hour leaving till tomorrow
Plate from yesterday didn't grow
electroporating and plating cytoTXS2-MBP again today
Plate:
- 15 uL agar
- 30 uL xgal
- 150 uL IPTG
- 15 uL antibiotic
9/2/22: check on TXS plate : plate did not grow. Need to ask Brian/Simon about.
run gel of T5AT remeber to spin down the 1kb ladder
1kb recipe:
- 0.33uL ladder
- 0.33uL dye
- 1.32uL H2O
- lane 1: 1kb ladder
- lane 2: T5AT
Future directions:
Run another plate of cytoTXS2-MBP
Take extra colonies from T5AT plate and do grow ups
9/7/22: Transforming and plating cytoTXS2-MBP -(zap tube label)
Future directions:
Make more LB broth and agar for plates
ran out of agar so can not plate till more is made
As of today, we have:
A TDS2 B
B CRTE C
C RUBY D
CTRE was made from Chlor BA-DC*
We will use these constructs in a Golden Gate reaction and insert them with pLSUK w BSAI (in the final construct folder)
9/8/22: Made agar and LB broth
Future directions:
Run new digest and gel of T5AT and electroporate and plate cytoTXS2-MBP
9/9/22 T5AT digest and gel:
- 14.5 ul H20
- 2 ul Buffer (10x) cutsmart
- 3 ul DNA
- 0.5ul Restriction enzyme (BsaI) -> should have used Pacq1 since the golden gate was done with Bsa1
gel:
lane 1: 1kb ladder
lane 2: TXS
lane 4: ladder
9/10/22:
Do control with bakcbone with same resistance, that should grow, so if it does grow than it is a problem with the golden gate and if it doesn't grow it is an issue with the transformation
Future directions:
Grab three new colonies from T5AT plate and grow up do the control plate with cytoTXS but its backbone that I know will grow so the ChlorA-DB backbone should work (check that I am useing the correct vial of Chlor)*
*may need to make new vector of the promoter and terminator with TXS cuz I think I should be cutting with Pacq1 and right now it's cutting with BsaI
9/12/22: Golden gate:
- Water - 9.9uL H2O
- Ligase buffer - 2μL
- PLSUK BB - 0.8 uL
- TDS2 - 1.4uL
- CRTE - 2.3uL
- RUBY - 1.6uL
- BSAI -.75μL
- Ligase - 1.25μL
9/15/22: Plating of txs-ruby plasmid
Plating a control plate with the ChlorA -DB backbone
- 2 Microcentrifuge Tubes
- Cuvette
- 2 𝜇L Plasmid *Chlor A-DB bakcbone
- 25 𝜇L E. Coli (box with pink label)
- 950 𝜇L LB Broth
T5AT 1 9.15 G2
T5AT 2 9.15 G2
T5AT 3 9.15 G2
- 5mL LB Broth
- 5𝜇L Antibiotic-> amp for T5AT plate on 7/20 in Amp BC
- 1 Colony
9/16/22: overnight broth of 2 txs-ruby plasmid
Put in fridge to do digest later
9/17/22: mini prep of txs-ruby plasmids
9/19/22: Nanodrop, digest and gel of the 2 txs-ruby plasmids with pstI, both looked good on the gel. 1 had a concentration of around 24, the second had a concentration of around 96.
Digest and run gel of T5AT
Digest use PaqCI
- 14.24uL H2O
- 2uL 10x cut smart buffer
- 3uL DNA
- 0.5uL PaqC1
- 0.5uL PaqC1 activator
lane1 1Kb ladder
lane2 T5AT1
lane3 T5AT2
lane4 T5AT3
lane5 1Kb ladder
Redoing cytoTXS-MBP golden gate
- 7.75ul H2O
- 2ul Ligase Buffer
- 1.3ul ChlorA-DB backbone
- 1.8ul Gmubi promoter
- 3.00ul CytoTXS-MBF
- 1.4ul At HSP
- 0.75ul PaqCI
- 0.75ul PaqCI Activator
- 1.25ul Ligase
Redo goldeen gate of T5AT
Maya said she would plate TXS golden gate for us tonight so we can grow up tomorrow
9/20/22: prepation of overnight broth and 1L YEP growth medium to prepare more EHA 105 stock.
9/21/22: Innoculation of 1L YEP medium with 20mL overnight EHA 105s at roughly 11am
- At 2pm, OD600 is 0.013
- At 4:30, OD600 is 0.036
- At 6:20, OD600 is 0.05
Plate Maya streaked out for us:
Three colonies grabbed for grow up
Tomorrow do miniprep/diigest/gel
9/22/22: Digest TXS minipreps with BsaI
Gel:
lane 1:1 Kb ladder
lane 2: TXS 1
lane 3: TXS 2
lane 4: TXS 3
lane 5: 1Kb ladder
9/23/22: Redoing cytoTXS-MBP golden gate
- 7.75ul H2O
- 2ul Ligase Buffer
- 1.3ul ChlorA-DB backbone
- 1.8ul Gmubi promoter--think I used the one with a different concentration but seems to be done to very little left in the other vial
- 3.00ul CytoTXS-MBF
- 1.4ul At HSP
- 0.75ul PaqCI
- 0.75ul PaqCI Activator
- 1.25ul Ligase
9/24/22: Electroporated and plated cytoTXS-MBP Golden Gate
9/26/22: sent off final plasmids for sequencing, electroporated final plasmids into EHA 101's and plated on yep agar medium.
Miniprep and digest of cytoTXS-MBP
9/27/22: EHA's look like they are growing very small colonies!
9/28/22: The crteTXS ruby plasmid grew great colonies in agrobacterium. 4 colonies were selected from each of the two plates and put into an overnight yep broth with KAN
Use 9/12 golden gate into Chemically competent stable cells
9/29/22: The plasmidsaurus sequencing of both miniprepped final plasmids looked great! All of the pulled agrobacterium colonies grew! These were miniprepped and I preformed a check PCR on all 8 of them, this shows that there is indeed the correct plasmid inside the agrobacterium but does not check for specific mutations. I chose final plasmid 'E' to grow up overnight in a YEP broth. This broth will be used to test how much overnight broth needs to be used to innoculate YEP medium if it were to replace AB minimal medium in the plant transfection protocol.
9/30/22: Buffers made in preparation for transforming beans this weekend with the crtetxs-ruby plasmid.
Sterilized 20 williams 82 beans.
At 5:30, innoculate 2 test samples of 125mL of yep to guesstimate how much yep needs to be onnoculated for an overnight OD of 0.6.
10/1/22: At 10:30AM, 125ml yep with 100ul innoculatn has an OD 600 of 0.1. 125ml of yep with 500ul innoculation has an OD600 0f 0.442. An OD600 of 0.442 is really good because it is less than 0.6 but not by that much. Tonight I will choose to innoculate the YEP with with 500ul and 700ul of the overnight broth with plasmid 'E' for the actual plant transformation.
Golden gate to make in chlor T5OH BD and electroporated, plated
10/2/22: at 9:30, spectrophototmeter blanked. Yep medium 'A" with 500ul innoculant has an OD600 of 0.445A. Yep medium 'B' with 700ul innoculant has an OB600 of 0.627. Will add needed mediums to the infection medium and then remeasure YEP 'A'. spun down two 35mL of the 0.445A. Simon modified plant protocol to include DTT and cystine to the infection and co cultivation mediums. to 100ml of each, 40mg cystine and 100uL 100x DTT to spun down agrobacterium, resuspended with 26mL of infection medium. Cystine and DTT are strong reducing agents and should help increase transformation effeciency by preventing the beans system of defene, oxygen radicles like peroxide, from functioning. additions to the infection medium were just made on the bench per Simon's instructions not under the laminar hood.
Infection medium + agrobacterium gently orbiting on level 3.5 of a red roter orbital shaker plate- just enough to keep the agrobacterium suspended.
Into laminar hood disinfected with large amounts of spray 70% ethanol, we brought the foil wrapped bean dish, scapel and new, wrapped blade. Preformed bean surgery on all 20 beans.
Under laminar hood, added additions to melted co cultivation medium. Cystine difficult to get out of tube, used pipette to suspend in the cultivation medium and then put back in. poured 6 plates.
benzyl amino purine causing meristem to make many shoots by differentianting, auxin basically turns everything into a meristem.
something with the golden gate for chlor T5OH BD did not go great and plates were mostly blue with just a few white colonies. Tried to pull and isolate these colonies by streaking onto new chlor plates.
10/3/22: New streak plates worked for chlor T5OH BD, colonies pulled and put into overnight broth
10/4/22: Overnight broths of chlor T5OH BD miniprepped and digested
Chemically Competent cell transformation of new golden gate
10/5/22: Ran a gel elctrophoresis on the digests of chlor T5OH BD.
10/7/22: Moved beans on plates to culture vessels