Successfully amplifying the pfa A and pfa D genes, cloning pfa D into pColdI vector and expressing pfa D protein.
The pColdI plasmids were extracted from the cultured bacteria and subjected to NdeI and XbaI digestion. The gel electrophoresis result showed the backbone of pColdI (4.3 kb) and stuffer (1.3 kb) as expected.
Figure 1: The agarose image shows the digestion result of pColdI.
To clone the extraordinarily large (~8 kb) pfa A from the genome of Moritella marina, we designed primers to clone two regions, pfa A1 (~4.8 kb) and pfa A2 (~4 kb). The pfa A1 and pfa A2 can be fused into the full length pfa A though an endogenous EcoRI site.
The restriction enzyme NdeI site at the 5' terminal of pfa A1 was generated with the forward primer and added through PCR using pfu DNA polymerase.
The primer sequence are listed below:
NdeI-pfa A1-F: CATATGGCTAAAAAGAACACCACATC
pfa A1-R: CCGCGGAGGTAAGTCAGTAA
The gel electrophoresis result showed the size of pfa A1 amplicon (4.8 kb) as expected.
Figure 2: The agarose image shows the amplicon of pfa A1.
The restriction enzyme SacII site at 3' terminal of pfa A2 was generated with the reverse primer pair and added through PCR using pfu DNA polymerase.
The primer sequences are listed below:
pfa A2 386-F: TGACTTAGGTATCGACTCAA
SacII-pfa A2-R: CCGCGGTTATGACATATCGTTCAAAAT
The gel electrophoresis result showed the size of pfa A2 amplicon (4 kb) as expected.
Figure 3: The agarose image shows the amplicon of pfa A2.
In addition, we also tried to amplify the whole pfa A without splitting. According, we performed PCR with the following primer pairs with using pfu DNA polymerase:
NdeI-pfa A1-F: CATATGGCTAAAAAGAACACCACATC
SacII-pfa A2-R: CCGCGGTTATGACATATCGTTCAAAAT
The gel electrophoresis result showed the size of pfa A amplicon (8 kb) as expected.
Figure 4: The agarose image shows the amplicon of pfa A.
To clone pfa D (~1.6 kb) from the genome of Moritella marina, we designed a forward primer with a ribosome binding site (RBS) and a restriction enzyme SacII site at the 5' terminal, while the 3' terminal of reverse primer is ended by restriction enzyme XbaI site. PCR amplification was performed with the designed primer pair and pfu DNA polymerase.
The primer sequences are listed below:
SacII-RBS-pfa D-F:
CCGCGGAGATATACCATGTCGAGTTTAGGTTTTAA
XbaI-pfa D-R: TCTAGATTAATCACTCGTACGATAACTTG
The gel electrophoresis result showed the size of pfa D amplicon (1.6 kb) as expected.
Figure 5: The agarose image shows the amplicon of pfa D.
After gel electrophoresis, the pfa D amplicon was purified from agarose gel and ligated with TA-vector. The ligated TA-pfa D was then transformed into E. coli DH5α strain, and the colonies after antibiotic (Amp) selection were subjected to colony PCR.
Figure 6: The agarose image shows the colony PCR result of
TA-pfa D.
The clones showing expected amplicon size (1.6 kb) in colony PCR were then expanded for TA-pfa D plasmid extraction, and the extracted TA-pfa D plasmids were subjected to restriction enzyme digestion by HindIII.
Figure 7: The agarose image shows the digestion result of
TA-pfa D.
The clones showing expected amplicon size (1.6 kb) in colony PCR were then expanded for TA-pfa D plasmid extraction, and the extracted TA-pfa D plasmids were subjected to restriction enzyme digestion by HindIII.
Figure 8: The electrogram shows the Sanger sequencing result of
TA-pfa D.
Finally, we sequence-confirmed the TA-pfa D.
The pfa D amplicon is excised from the TA-pfa D vector by SacII and XbaI digestion, and the purified amplicon is ligated into pColdI vector. The colonies grown after standard transformation were examined by colony PCR using a primer pair recognizing pfa D 1369-F and pColdI-R. The size of the target amplicon of colony PCR is 0.3 kb in length.
The primer sequences are listed below:
pfa D 1369-F: TCTTCACGCTGGTCAAACAC
pColdI-R: CCAAATGGCAGGGATCTTAG
Figure 9: The agarose image shows the colony PCR result of
pColdI-pfa D.
The pColdI-pfa D vectors were then purified from colonies and confirmed by Sanger sequencing.
Figure 10: The electrogram shows the Sanger sequencing result of
pColdI-pfa D.
We transformed pColdI-pfa D into E. coli BL21 strain and induced protein expression through culturing bacteria in TB medium with 1 mM IPTG at 16 °C for 4 hr. The bacteria was then harvested and subjected to SDS-PAGE analysis and Coomassie blue staining. The predicted size of pfa D protein is 60 kDa. However, we did not observe the induced protein at the corresponding size. We inferred that the induction was inefficient.
Figure 11: The Coomassie blue staining showed the induction of
pfa D proteins.
Therefore, we extended the induction time to 9, 11 and 13 hr. All collected samples were subjected to SDS-PAGE analysis and Coomassie blue staining. In the staining image, we clearly observed the induced protein with the size around 45 kDa. We have confirmed that there is no premature stop codon in pColdI-pfa D. We will perform experiments to confirm whether there is unexpected protease activity or we may optimize the condon near the suspected premature ending site.
Successfully amplifying the pfa B (for DHA production), pfa B' (for EPA production), pfa C and pfa E genes, cloning pfa E into pSTV28 vector and expressing pfa E protein.
The pSTV28 plasmids were extracted from the cultured bacteria and subjected to EcoRI and BamHI digestion. The gel electrophoresis result showed the sizes of restriction fragments of pSTV28 (4, 0.5, 0.5 kb).
Figure 13: The agarose image shows the digestion result of
pSTV28.
To clone the pfa B (~2.6 kb) from the synthesized biobrick by the company, we designed the forward primer with a restriction enzyme EcoRI site at the 5' terminal, while the 3' terminal of reverse primer is ended by restriction enzyme BamHI site. The PCR amplification is performed by the designed primer pair and pfu DNA polymerase.
The primer sequence are listed below:
EcoRI-pfa B-F: GAATTCATGACGGAATTAGCTGTTAT
BamHI-pfa B-R: GGATCCTTATTTGTTCGTGTTTGC
The gel electrophoresis result showed the size of pfa B amplicon (2.6 kb) as expected.
Figure 14: The agarose image shows the amplicon of pfa B.
To clone the pfa B' (~2.3 kb) from the gene block synthesized by the company, we designed the forward primer with a restriction enzyme EcoRI site at the 5' terminal, while the 3' terminal of reverse primer is ended by restriction enzyme BamHI site. The PCR amplification is performed using the designed primer pair and pfu DNA polymerase.
The primer sequences are listed below:
EcoRI-pfa B EPA-F: GAATTCATGGAACAAACGCCTAA
BamHI-pfa B EPA-R: GGATCCTTAGACTTCCCCTTGAAG
The gel electrophoresis result showed the size of pfa B' amplicon (2.3 kb) as expected.
Figure 15: The agarose image shows the amplicon of pfa B'.
To clone the pfa C (~6 kb) from the genome of Moritella marina, we designed the forward primer with a ribosome binding site (RBS) and a restriction enzyme BamHI site at the 5' terminal, while the 3' terminal of reverse primer is ended by restriction enzyme SacI site. The PCR amplification was performed using the designed primer pair and pfu DNA polymerase.
The primer sequences are listed below:
BamHI-RBS-pfa C-F:
GGATCCGGAGATATACCATGGAAAATATTGCAGTAGTAGG
SacI-pfa C-R: GAGCTCTTACGCTTCAACAATACTTAAAAC
The gel electrophoresis result showed the size of pfa C amplicon (6 kb) as expected.
Figure 16: The agarose image shows the amplicon of pfa C.
To clone the pfa E (~0.8 kb) from the synthesized biobrick by company, we designed the forward primer with a ribosome binding site (RBS) and a restriction enzyme SacI site at the 5' terminal, while the 3' terminal of reverse primer is ended by restriction enzyme HindIII site. The PCR amplification was performed using the designed primer pair and pfu DNA polymerase.
The primer sequences are listed below:
SacI-RBS-pfa E-F:
GAGCTCGGAGATATACCATGTACAGCGGCGTAAAA
HindIII-pfa E-R: AAGCTTCTATTTAGCGTCAGGTTTAAAAT
The gel electrophoresis result showed the size of pfa E amplicon (0.8 kb) as expected.
Figure 17: The agarose image shows the amplicon of pfa E.
After gel electrophoresis, the pfa E amplicon was purified from agarose gel and ligated with TA-vector. The ligated TA-pfa E was then transformed into E. coli DH5α strain, and the colonies after antibiotic (Amp) selection were subjected to colony PCR.
Figure 18: The agarose image shows the colony PCR result of
TA-pfa E.
The clones showing expected amplicon size (0.8 kb) in colony PCR were then expanded for TA-pfa E plasmid extraction, and the extracted TA-pfa E plasmids were subjected to restriction enzyme digestion by HindIII.
Figure 19: The agarose image shows the digestion result of
TA-pfa E.
The clones with correct restriction digestion map (2.7 kb for TA vector and 0.8 kb for pfa E) were subjected to sequencing confirmation.
Figure 20: The electrogram shows the Sanger sequencing result of
TA-pfa E.
Finally, we sequence-confirmed the TA-pfa E.
The pfa E amplicon was excised from the TA-pfa E vector by SacI and HindIII digestion, and the purified amplicon was ligated into pSTV28 vector. The colonies grown after standard transformation were examined by colony PCR using a primer pair recognizing SacI-RBS-pfa E-F and HindIII-pfa E-R. The size of the target amplicon of colony PCR is 0.8 kb in length.
The primer sequences are listed below:
SacI-RBS-pfa E-F:
GAGCTCGGAGATATACCATGTACAGCGGCGTAAAA
HindIII-pfa E-R: AAGCTTCTATTTAGCGTCAGGTTTAAAAT
Figure 21: The agarose image shows the colony PCR result of
pSTV28-pfa E.
The pSTV28-pfa E vectors were then purified from colonies and confirmed by Sanger sequencing.
Figure 22: The electrogram shows the Sanger sequencing result of
pSTV28-pfa E.
We transformed pSTV28-pfa E into E. coli BL21 strain and induced protein expression through culturing bacteria in TB medium with 1 mM IPTG at 37 °C for 4 hr. The bacteria was then harvested and subjected to SDS-PAGE analysis and Coomassie blue staining. The predicted size of pfa E protein is 32 kDa. The staining result clearly showed the induction of pfa E proteins.
Figure 23: The Coomassie blue staining showed the induction of
pfa E proteins.
To optimize the protein expression, we performed a time course examination. The protein expression was induced by culturing bacteria in TB with 1 mM IPTG at 37 °C for 2, 4 and 8 hr. All collected samples were subjected to SDS-PAGE analysis and Coomassie blue staining.
Because the induction was inefficient, we further optimized the protein expression by extending the inducing time. The protein expression was induced by culturing bacteria in TB with 5 mM IPTG at 37 °C for 8, 18 and 24 hr. All collected samples were subjected to SDS-PAGE analysis and Coomassie blue staining. The staining result showed the induction of pfa E proteins around 32 kDa.
Successfully amplifying the AccBC and AccD1E genes, cloning AccD1E into pET28a vector and expressing ACCD1 protein.
The pET28a plasmids were extracted from the cultured bacteria and subject into SspI and SapI digestion. The gel electrophoresis result showed the sizes of restriction fragments of pET28a (3.6, 1.2, 0.6 kb).
Figure 26: The agarose image shows the digestion result of
pET28a.
To clone the AccBC (~1.8 kb) from the gene block synthesized by the company, we designed a forward primer with a ribosome binding site (RBS) and a restriction enzyme NdeI site at the 5' terminal, while the 3' terminal of reverse primer is ended by restriction enzyme EcoRI site. The PCR amplification was performed using the designed primer pair and pfu DNA polymerase.
The primer sequences are listed below:
AccBC-F: CATATGATGTCAGTCGAGACTAGGAA
AccBC-R: GAATTCTTACTTGATCTCCAGG
The gel electrophoresis result showed the size of AccBC amplicon (1.8 kb) as expected.
Figure 27: The agarose image shows the amplicon of AccBC.
After gel electrophoresis, the AccBC amplicon was purified from agarose gel and ligated with TA-vector. The ligated TA-AccBC was then transformed into E. coli DH5α strain, and the colonies after antibiotic (Amp) selection were subjected to colony PCR.
Figure 28: The agarose image shows the colony PCR result of
TA-AccBC.
The clones showing expected amplicon size (1.8 kb) in colony PCR were then expanded for TA-AccBC plasmid extraction, and the extracted TA-AccBC plasmids were subjected to restriction enzyme digestion by NdeI and EcoRI.
Figure 29: The agarose image shows the digestion result of
TA-AccBC.
The clones with correct restriction digestion map (2.7 kb for TA vector and 1.8 kb for AccBC ) were subjected to sequencing confirmation.
Figure 30: The electrogram shows the Sanger sequencing result of
TA-AccBC.
Finally, we sequence-confirmed the TA-AccBC.
To clone the AccD1E (~2 kb) from the gene block synthesized by the company, we designed a forward primer with a ribosome binding site (RBS) and a restriction enzyme EcoRI site at the 5' terminal, while the 3' terminal of reverse primer is ended by restriction enzyme XhoI site. PCR amplification was performed using the designed primer pair and pfu DNA polymerase.
The primer sequences are listed below:
AccD1E-F: GAATTCGGAGATATACCATGACCATTT
AccD1E-R: CTCGAGCTAGAAGAAATTCACATTC
We then performed PCR to amplify the target fragment. The result showed that the amplicon sizes of AccD1E (2 kb) as expected.
Figure 31: The agarose image shows the amplicon of AccD1E.
After gel electrophoresis, the AccD1E amplicon was purified from agarose gel and ligated with TA-vector. The ligated TA-AccD1E was then transformed into E. coli DH5α strain, and the colonies after antibiotic (Amp) selection were subjected to colony PCR.
Figure 32: The agarose image shows the colony PCR result of
TA-AccD1E.
The clones showing expected amplicon size (2 kb) in colony PCR were then expanded for TA-AccD1E plasmid extraction, and the extracted TA-AccD1E plasmids were subjected to restriction enzyme digestion by EcoRI and Xhol.
Figure 33: The agarose image shows the digestion result of
TA-AccD1E.
The clones with correct restriction digestion map (2.7 kb for TA vector and 2 kb for AccD1E) were subjected to sequencing confirmation.
Figure 34: The electrogram shows the Sanger sequencing result of
TA-AccD1E.
Finally, we sequence-confirmed the TA-AccD1E.
The AccD1E amplicon was excised from the TA-AccD1E vector by EcoRI and XhoI digestion, and the purified amplicon was ligated into pET28a vector. The colonies grown after standard transformation were examined by colony PCR using a primer pair recognizing AccD1E-1721 F and T7 terminator. The size of the target amplicon of colony PCR is 0.3 kb in length.
The primer sequences are listed below:
AccD1E 1721-F: ATCGTATCTGGCAACCCAAC
T7-terminator: GCTAGTTATTGCTCAGCGG
Figure 35: The agarose image shows the colony PCR result of
pET28a-AccD1E.
The pET28a-AccD1E vectors were then purified from colonies and confirmed by Sanger sequencing.
Figure 36: The electrogram shows the Sanger sequencing result of
pET28a-AccD1E.
We transformed pET28a-AccD1E into E. coli BL21 strain and induced protein expression through culturing bacteria in TB medium with 0.4 mM IPTG at 37 °C for 2, 3 and 4 hr. The bacteria was then harvested and subjected to SDS-PAGE analysis and Coomassie blue staining. The predicted size of ACCD1 and ACCE protein are 60 and 10 kDa, respectively. The staining result clearly showed the induction of ACCD1 protein around 60 kDa. The ACCE protein expression will be further examined by using 15% gel in SDS-PAGE analysis and Coomassie blue staining.
Figure 37: The Coomassie blue staining showed the induction of
ACCD1 protein.
Successfully determine the ideal concentration of antibiotics for pColdI, pSTV28 and pET28a vectors to co-exist in E. coli.
To confirm that the pColdI (Ampicillin resistant) and pSTV28 (Chloramphenicol resistant) can be co-expressed in the bacteria to establish the pfa megasynthase expression system, we first performed double antibiotic selection for pColdI and pSTV28 vectors.
We started by fixing the concentration of ampicillin at 50 μg/ml, which is generally applied to select plasmids with Amp-resistance. The transformed copy number of plasmid was fixed at 109. A range of chloramphenicol concentrations from 5 to 20 μg/ml was selected according to the reports using the pSTV28 vector as expression vector.
The selection result showed an apposite number of colonies at 10 μg/ml of chloramphenicol. Therefore, we selected the Amp (50 μg/ml) and Cm (10 μg/ml) for the double antibiotic selection.
| Copy number of each plasmid: 109 ; Ampicillin: 50 μg/ml | |||||
| Chloramphenicol | Colony number | Mean | SD | ||
| 5 μg/ml | 232* | 1240 | 1244 | 1242 | 2082 |
| 10 μg/ml | 255 | 360 | 542 | 386 | 145 |
| 20 μg/ml | 206 | 437 | 937* | 322 | 163 |
*outliers excluded from the average.
To further confirm that the two kinds of plasmids are co-expressed in the colonies, we randomly selected some of the colonies and purified the plasmids from these colonies. The purified plasmids were digested with restriction enzyme SapI. The gel electrophoresis result showed the sizes of restriction fragments of pColdI (5.7 kb) and pSTV28 (4.2, 0.9 kb) as expected.
Figure 38: The agarose image shows the digestion result of pColdI
and pSTV28.
To confirm that the pfa-expressing vectors (pColdI and pSTV28) can be co-expressed with pET28a (kanamycin resistant) vector, we performed triple antibiotic selection.
According to the result of double antibiotics selection, we started the triple antibiotic selection by fixing the concentration of Amp (50 μg/ml) and Cm (10 μg/ml). However, this condition was too harsh when adding kanamycin as the third antibiotic, and only a few colonies survived. We then decreased the concentration of chloramphenicol to 5 μg/ml, and performed triple antibiotics selection with 1.25 μg/ml, 2.5 μg/ml and 5 μg/ml kanamycin.
The result showed an apposite number of colonies at 5 μg/ml of kanamycin. Therefore, we selected Amp (50 μg/ml), Cm (5 μg/ml) and Kan (5 μg/ml) for the triple antibiotic selection.
| Copy number: 109 ; Ampicillin: 50 μg/ml, Chloramphenicol: 5 μg/ml | |||||
| kanamycin | Colony number | Mean | SD | ||
| 1.25 μg/ml | > 1000 | > 1000 | > 1000 | X | X |
| 2.5 μg/ml | 134 | 252 | 534 | 193 | 83 |
| 5 μg/ml | 79 | 139 | 179 | 132 | 50 |
To further confirm that the three kinds of plasmids are co-expressed in the colonies, we randomly selected some colonies and purified the plasmids from these colonies. The purified plasmids were digested with restriction enzymes XbaI and BamHI. The gel electrophoresis result showed the sizes of restriction fragments of pColdI (4.4, 1.2 kb), pSTV28 (3.2, 1.4, 0.5 kb) and pET28a (5.6 kb) as expected. The five colonies have been conducted plasmid extraction and digestion, and the results are shown in below.
Figure 39: The agarose image shows the digestion result of
pColdI, pSTV28 and pET28a.
Through the double and triple antibiotic selection, we set up conditions which allow pColdI and pSTV28, or pColdI, pSTV28 and pET28a vectors to co-exist in E. coli. Therefore, we can co-transformed our engineering plasmids into E. coli and co-expressed the pfa megasynthase with ACC enzymes to produce EPA.