PARTNERSHIP
Jilin_China
In 2021, BS_United_China and Jilin_China cooperated, and in 2022, there was a deeper cooperation. In this case, we define it as our partnership.
Project adjustment
During the brainstorming stage, due to the epidemic, we could not meet offline, so we had several online meetings and exchanges. Jilin_China proposes the treatment of metal ions, including iron, copper, zinc, lead, cadmium and other metal ions. However, B's advisor Wu proposed that designing too many metal ions will intense the bacterial burden, and he hoped us can pick some typical metals for processing. At the same time, since Jilin_China has used AIP's quorum system in 2020, Jilin_China helped BS_United to perfect their design of AIP system. Finally, by combining with HP's opinion, Jilin_China identified three metal ions of copper, zinc and lead. At the same time, BS_United perfected their AIP system.
Fig1. Modified TurboID design
Part perfection
We believes that the TurboID-AgrD fusion expression can achieve the targeted biotinylation modification and blocking of TurboID. Jilin_China believes that AgrD protein is expressed on the cytoplasmic side, and the C-terminus of the protein is likely to bind to the inner region of AgrB and undergo cleavage. Therefore, after discussion, the C-terminal region was removed leaving the N-terminal and AIP regions for proper folding and function.
Project promotion
In the process of the project, Jilin_China distributed a questionnaire to count people's acceptance of bio-governance. However, after statistics, it was found that most of the participants were college students, so We helped Jilin_China to distribute the questionnaires among high school students and the elderly in the community. The questionnaire obtained more age diversity.
Fig2. Questionnaire sent on WeChat toward college and high school students
Composite Part design
Jilin_China designed a lead ion sensor based on pbr operon and surface display system. BS_United raised the question of how to directionally identify the pbrR that has bound lead ions and the PbrR that has not bound lead ions, so as to achieve quantification. The two parties discussed and found that since pbrR will combine with pbrR to form dimer, it will affect the adsorption and induction of lead ions. And due to the particularity of biological systems, the adsorption capacity of pbrR to lead ions cannot be measured, so we suggest that we revise the content of this part.
In the process of optimization, we proposed that the turboID in our project could be used as a fusion expression with pbrR. TurboID will use proximity labeling to target the bacteria before hand then the bacteria will be sent for pb2+ detection.
Fig.3 Composite part of TurboID and Lpp-OmpA-PbrR.
When pbr R reacts for a period of time, the remaining binding amount of pbrR can be detected by a fluorescent label, so as to detect the purpose of determining the number of pbrR monomers after a period of time. Such a method provides an important aid for our subsequent optimization of the expression of lead ions and surface display systems.
During plasmid construction, our team and Jilin_China jointly optimized the vector selection and expression system,and continue to verify in the future.
Our purpose is to detect the quantity of the monomer pbrR protein which can combine with the turboid-pbrR fusion protein.And with the combination of the biotin and streptavdin-cy3, the fluorescent signal can be observed.
With different concentration of the Pb2+ in the culture medium:(A)0mM;(B)1μM;(C)10μM;(D) 1mM.DAPI channel was used the concentration of the bacteria,the Cy3 channel was used to verify the quantity of the pbrR protein which is not combined with the Pb2+.The result showed that the number of the monomer pbrR protein decreased when there is a higher concentration of the Pb2+.This provided us with the possibility to evaluate the function of our surface display system.
Fig.4 Use TurboID-pbrR protein as an important illustration to qualify the LPP-pbrR bacteria
SgRNA modification
In the process of project our gene needs to be knocked out, but as high school students we have little experience , so Jilin_China provides the Crispri system designed in 2021 to help us improve the project. In the process of cooperation in 2021, we found that there is such a need. Jilin_China provides the CRISPR i system in 2021 and guides the design ideas of sgRNA. Based on the previous literature, BS_United initially prepared two sgRNAs, AAAGTCGCAGTAGTATGCAC, AGAGTCGCAATTGTCTGCAC. (He Yuxin) communicated together and found that the sequences provided by BS_United had many off-targets. After redesign, one sgRNA. Jilin_China without off-targets was selected, AAAGTCGCAATTGTATGCAC
HP assistance
Jilin_China helped us to contact experts in the food field. In the online video conference with the expert, she introduced to BS_United the standards, processes and methods of quality testing in the food industry from the perspective of policies, regulations and industry standards. In the laboratory operation link that we were interested in, she explained to us the sampling and testing standards of meat products, dairy products and other fresh food in the laboratory, and things need to pay extra attention.These shares have improved our understanding of laboratory operations.
Fig. 4 Conference introduced by Jilin_China
Education
During the process of education part, the two parties jointly issued an official account for transgenic and synthetic biology issues that young people and the elderly care about, The two sides organized the collected questions and launched the "20 Whys" column on the official account, introduced synbio and questions concerned by the public. In the official account, we shared and introduced the previous team projects.
Fig.5 Communication through e-mail and questionnaire sent by both teams
Fig.6 Published scientific article in our official account
On the eve of the wiki freeze, the two sides had a final exchange, checking each other's projects and pages