CONTRIBUTION


BBa_K3883031

dCas9 system was introduced by Jilin_China in 2021 used for cutting the activity of nucleic acid in order to inhibit specific gene expression. We utilized this part to decrease the level of Bifuntional BirA enzyme which further increase the Biotin accumulation in E. coli. This system insure the maximum yield of biotin in our experiment. We have designed a sgRNA sequence(AAGTCACCATACGTTAGTAC) targeting the Bifuntional BirA enzyme after the production of biotin to prevent biotin from further disintegration.


BBa_K2457001

The Cas9 system was introduced by iGEM17_Amazonas_Brazil in 2017. We utilized this part to create our QS suicidal system. Cas9 will be targeted toward ATP synthase of our engineered bacteria with our designed sgRNA(AAAGTCGCAATTGTATGCAC). We wanted to prevent environmental contamination by inhibiting the ATP synthase in the bacteria thereby resulting in killing of the bacteria.


BBa_J23100

The family of constitutive promoter was introduced by iGEM2006_Berkeley in 2006. We utilized their project as the promoter of sgRNA sequence in our QS suicidal system. Cas9 will activate the constitutive promoter and then activate sgRNA sequence to target the desired region which is ATP synthase.