Protocols


Bacterial Cultures

Introduction

LB Medium is a nutrient-rich microbial growth medium used for the cultivation of E. coli. We used pre-mixed powder according to Lennox from PanReac.

Details

Reagents and equipment

  • Pre-mixed LB-Medium powder according to Lennox.
  • dH2O
  • Flask
  • Sterile Bottle
  • Autoclave
  • Weighing Machine
Composition of pre-mixed LB-Medium powder
  • NaCl 5 g/L
  • Tryptone 10 g/L
  • Yeast extract 5 g/L
Procedure

  1. For the preparation of 1 L of LB-agar weigh 20g of the pre-mixed powder.
  2. Dissolve it in 1 L of dH2O. For larger or smaller volumes of the mixture scale up or down respectively.
  3. Autoclave the mixture.
  4. If the addition of antibiotics is needed, it can be added after the mixture has cooled, since it is sensitive to high temperatures. This is approximately the temperature that you can hold the flask that contains the LB-Medium only with lab gloves.

Introduction

LB Agar is a nutrient-rich microbial growth medium used for the preparation of LB Agar plates for cultivation of E. coli. We used pre-mixed powder according to Lennox from PanReac.

Details

Reagents and equipment

  • Pre-mixed LB-agar powder according to Lennox.
  • dH2O
  • Flask
  • Sterile Bottle
  • Autoclave
  • Weighing Machine
Composition of pre-mixed LB-Medium powder
  • Agar 15 g/L
  • NaCl 5g/L
  • Tryptone 10 g/L
  • Yeast extract 5 g/L
Procedure

  1. For the preparation of 1 L of LB-agar weigh 35 g of the pre-mixed powder.
  2. Dissolve it in 1 L of dH2O. For larger or smaller volumes of the mixture scale up or down respectively.
  3. Autoclave the mixture.
  4. Let the mixture cool down approximately at 60o C before you add the appropriate quantity of antibiotic if it is needed. If you are using a 1000x stock solution of antibiotic, calculate the volume of the stock solution that you should add to the mixture by dividing the volume of the LB-agar you are preparing with 1000.
  5. Add the antibiotic with a pipette directly into the mixture and swirl the bottle in order to ensure that the antibiotic is distributed evenly.

Introduction

Preparation of LB-agar plates with different antibiotics is a crucial procedure in a microbiology lab as they are utilized for culturing bacteria in the lab. This protocol is based on Addgene's " Pouring LB Agar Plates" protocol. For the preparation of LB-agar we used premixed powder according to LENOX.

Details

Reagents and equipment

  • Pre-mixed LB-agar powder according to Lennox.
  • dH2O
  • Flask
  • Sterile Bottle
  • Autoclave
  • Weighing Machine
  • Sterile pipettes
  • Ice bucket
  • Sterile plates of your desired size
  • Antibiotic at 1000 x concentration dissolved in the appropriate liquid solvent
Procedure

  1. For the preparation of 1 L of LB-agar weigh 35 g of the pre-mixed powder.
  2. Dissolve it in 1 L of dH2O. For larger or smaller volumes of the mixture scale up or down respectively.
  3. Autoclave the mixture.
  4. Light the flame at the plate pouring station and dilute your antibiotic into your 50-60oC molten gel mix using sterile technique.
  5. Swirl the agar bottle to ensure even distribution of the antibiotic throughout the agar
  6. Open one plate at a time next to the flame and begin pouring.
  7. Leave your plates out on the bench to solidify.

Introduction

Bacterial glycerol stocks are essential for long-term storage of plasmids. A glycerol stock of bacteria can be stored stably at -80oC for many years. This protocol is based on Addgene's protocol "Creating Bacterial Glycerol Stocks for Long-term Storage of Plasmids".

Details

Reagents and equipment

  • Liquid bacterial cultures
  • 50% glycerol
  • Pipette & tips
  • Tubes
Procedure

    Preparation of the liquid bacterial culture
  1. For the preparation of the liquid bacterial culture follow the protocol: "Inoculation of liquid bacterial cultures”.
  2. Preparation of glycerol stock
  3. Into a tube, add 500 ul of the overnight liquid culture and 500ul of 50% glycerol
  4. Mix gently by inverting the tube
  5. Freeze and store the glycerol stock tube at -80oC
  6. Recovery of bacterial cells
  7. Use a sterile loop to scrape some of the bacteria off on the top of the glycerol stock and streak a plate with the appropriate antibiotic. Do not unthaw the glycerol stock.
  8. Grow overnight the bacteria at the appropriate temperature.

Introduction

This protocol describes two crucial procedures that are followed for isolating a single clonal population of bacteria from a glycerol stock or a stab culture. The protocol is based on Addgene's protocol l "Streaking and Isolating Bacteria on an LB Agar Plate".

Details

Reagents and equipment

  • Sterile toothpicks or wire loop
  • Bunsen burner
  • Incubator
  • Marker
  • LB Agar plate with appropriate antibiotic
  • Bacterial stab
Procedure

    Preparation
  1. Get an LB agar plate with the appropriate antibiotic
  2. Label the bottom of the plate with information like: the plasmid name, the date and antibiotic resistance.
  3. Sterilize your lab bench using 70% ethanol and working near a flame or Bunsen burner in order to maintain sterility.
  4. Get the desirable glycerol stock or bacterial stab.
  5. Streaking
  6. Using a sterile loop, touch the bacteria growing within the punctured area of the stab culture or the top of the glycerol stock.
  7. Gently spread the bacteria over a section of the plate, as shown in the diagram, to create streak #1
  8. Using another sterile toothpick, or freshly sterilized loop, drag through streak #1 and spread the bacteria over a second section of the plate, to create streak #2.
  9. Using a third sterilized loop, drag through streak #2 and spread the bacteria over the last section of the plate, to create streak #3.
  10. Isolation
  11. Incubate the plate with newly plated bacteria overnight (12-18 hours) at 37oC
  12. After the incubation, single colonies should be visible. A single colony should look like a white dot growing on the solid medium. If the bacterial growth is too dense and you do not see single colonies, re-streak onto a new agar plate to obtain single colonies.
  13. Once there are single colonies, they can be picked and then proceed to recovering plasmid DNA or use the individual colonies for other experiments.

Introduction

We used this protocol to prepare competent cells, able to be transformed by our parts.

Reagents and equipment

  • 350 ml 0,1 M CaCl2
  • 100% Glycerol
  • Erlenmeier sterile flasks
  • Centrifuge bottles
  • Incubator
  • Cooling centrifuge
  • Ice bucket filled with ice
Procedure

  1. Plate the cells on a plate. If the cells have any drug resistance integrated in them, use LB-Agar plates containing this resistance; otherwise use plain LB-Agar plates.
  2. Pick one colony and grow overnight in 25 ml LB at 37oC (containing the drug if resistance present)
  3. Transfer the cells to 500 ml LB final volume
  4. Incubate at 37oC for ~2,5h (until the OD reaches ~0.5)
  5. Centrifuge cells at 4oC for 15min at 5000RPM (Sorval)
  6. Discard the supernatant and re-suspend the pellet in 250ml 0,1M CaCl 2
  7. Incubate on ice for 20 min
  8. Centrifuge again as before
  9. Discard supernatant and re-suspend the pellet in 43ml 0,1M CaCl 2 (8.6ml per 50ml Falcon)
  10. Incubate for 2-12h (usually 4h)
  11. Add 7ml 100% glycerol and mix well (1.4ml per 50ml Falcon)
  12. Distribute in 1,5ml tubes
  13. Quick freeze in liquid nitrogen
  14. Store at -80oC

Introduction

A liquid bacteria culture is used to grow up enough bacteria, crucial to isolate enough plasmid DNA for experimental use. The protocol is based on Addgene's protocol “Inoculating a Liquid Bacterial Culture".

Details

Reagents and equipment

  • Liquid LB Medium
  • LB agar plate with bacterial cultures
  • Bunsen burner
  • Incubator
  • Falcon tubes
  • Pipette and tips
Procedure

  1. When ready to grow your culture, add liquid LB medium to a tube or flask and add the appropriate antibiotic to the correct concentration.
  2. Antibiotics Ampicillin Chloramphenicol Kanamycin Gentamycin Tetracycline
    Recommended concentration 100 μg/ml 25 μg/ml 50 μg/ml 10 μg/ml 10 μg/ml
  3. Select a single colony from the LB agar plate, using a sterile pipette tip or toothpick.
  4. Drop the tip or toothpick into the liquid LB with antibiotic and swirl.
  5. Loosely cover the culture with sterile aluminum foil.
  6. Incubate bacterial culture at 37°C for 12-18 hours in a shaking incubator.
  7. After incubation, check for growth, which is characterized by a cloudy haze in the media.

Cloning experiments

Introduction

For the reconstitution of the lyophilized primers we followed the provided by the Integrated DNA Technologies (IDT).

Details

Reagents and equipment

  • Lyophilized primers
  • ddH2O
  • Pipette & tips
  • Microfuge tubes
Procedure

    Before reconstitution
  1. Before opening, spin down the pellet for 30 sec at full speed, to collect all the powder at the bottom of the vial.
  2. Open the vial carefully, without touching the inside of the lid.
  3. Reconstitution of the primer (100μM storage solution)
  4. Find the oligo yield information (in nmol) on the tube label or specification sheet
  5. Multiply this number by 10
  6. The resulting product is the amount of ddH2O needed, in µL, to prepare a 100 µM solution.
  7. Mix gently by inverting the tube. Avoid mixing by pipetting, shaking or vortex.
  8. Preparation of a working stock (10μM)
  9. Dilute one part of the primer stock by adding 9 parts water, in order to create a 10 pmol/ul working stock concentration (1:10)

Introduction

Polymerase chain reaction (PCR) is a simple technique for the amplification of targeted DNA fragments in vitro. We followed the PCR protocol for “Q5 High-Fidelity DNA Polymerase”(New England Biolabs) and the biphasic PCR protocol introduced by Stamatios G.Damalas. We used the biphasic protocol in cases where our primers were long in base pairs and with high complexity.

Details More...

Reagents and equipment

  • 5x Q5 Reaction Buffer
  • 10 mM dNTPs
  • 10 μM Forward primer
  • 10 μM Reverse primer
  • Template DNA
  • Q5 High-Fidelity DNA Polymerase
  • Nuclease free water
  • Ice bucket filled with ice
  • Pipette & tips
  • Thermocycler
Procedure

  1. Add the following components in a PCR tube and gently mix (for a 25 μl reaction).
  2. 5X Q5 Reaction Buffer 5 μl
    10 mM dNTPs 0.5 μl
    10 μM Forward primer 1.25 μl
    10 μM Reverse primer 1.25 μl
    Template DNA variable
    Q5 High-Fidelity DNA Polymerase 0.25 μl
    Nuclease-free water to 25 μl
  3. Collect all liquid to the bottom of the tube by a quick spin if necessary.
  4. Introduce the PCR tubes in the thermocycler and use the following PCR protocol
  5. Standard PCR protocol
    Step Temperature Time
    Initial Denaturation 98oC 30 sec
    25-35 cycles 98 oC (Denaturation) 5-10 sec
    50-72 oC (Annealing) 10-30 sec
    72 oC (Extension) 20-30 sec/kb
    Final Extension 72 oC 2 min
    Hold 4-10 oC ∞
    Biphasic PCR protocol
    Step Temperature Time
    Initial Denaturation 98oC 2 min
    Phase 1 X 10 cycles 98 oC 20 sec
    50oC 20 sec
    72 oC Part dependent
    98 oC 20 sec
    Phase 2 X 25 cycles 76oC 20 sec
    72oC Part dependent
    72 oC 2 min
    Hold 4-10 oC ∞

Introduction

PCR Mutagenesis is a simple method for generating site-directed mutagenesis. We followed the PCR protocol for “Q5 High-Fidelity DNA Polymerase” (New England Biolabs).

Details

Reagents and equipment

  • 5x Q5 Reaction Buffer
  • 10 mM dNTPs
  • 10 μM Forward mutagenic primer
  • 10 μM Reverse primer
  • Template DNA
  • Q5 High-Fidelity DNA Polymerase
  • Nuclease free water
  • Ice bucket filled with ice
  • Pipette & tips
  • Thermocycler
Procedure

  1. Add the following components in a PCR tube and gently mix (for a 25 μl reaction).
  2. 5X Q5 Reaction Buffer 5 μl
    10 mM dNTPs 0.5 μl
    10 μM Forward mutagenic primer 1.25 μl
    10 μM Reverse primer 1.25 μl
    Template DNA variable
    Q5 High-Fidelity DNA Polymerase 0.25 μl
    Nuclease-free water to 25 μl
  3. Collect all liquid to the bottom of the tube by a quick spin if necessary.
  4. Introduce the PCR tubes in the thermocycler and use the following PCR protocol
  5. Step Temperature Time
    Initial Denaturation 98oC 30 sec
    25-35 cycles 98 oC (Denaturation) 5-10 sec
    50-72 oC (Annealing) 10-30 sec
    72 oC (Extension) 20-30 sec/kb
    Final Extension 72 oC 2 min
    Hold 4-10 oC ∞

Introduction

Colony PCR is a high-throughput method for determining the presence or absence of insert DNA in plasmid constructs. This method validates the correct assembly of our genetic parts with the plasmid backbone. We followed the PCR protocol for “Taq DNA Polymerase with Standard Taq Buffer” (New England Biolabs).

Details

Reagents and equipment

  • 10x Standard Taq Reaction Buffer
  • 10 mM dNTPs
  • 10 μM Forward primer
  • 10 μM Reverse primer
  • Template DNA
  • Taq DNA Polymerase
  • Nuclease free water
  • Ice bucket filled with ice
  • Pipette & tips
  • Thermocycler
Procedure

  1. Add the following components in a PCR tube and gently mix (for a 25 μl reaction).
  2. 10X Standard Taq Reaction Buffer 2.5 μl
    10 mM dNTPs 0.5 μl
    10 μM Forward primer 0.5 μl
    10 μM Reverse primer 0.5 μl
    Template DNA variable
    Taq DNA Polymerase 0.125 μl
    Nuclease-free water to 25 μl
  3. Collect all liquid to the bottom of the tube by a quick spin if necessary.
  4. Introduce the PCR tubes in the thermocycler and use the following PCR protocol
  5. Step Temperature Time
    Initial Denaturation 95oC 30 sec
    25-35 cycles 95 oC (Denaturation) 15-30 sec
    45-68 oC (Annealing) 15-60 sec
    68 oC (Extension) 1 min/kb
    Final Extension 68 oC 5 min
    Hold 4-10 oC ∞

Introduction

Agarose gel electrophoresis is a standard lab procedure for separating DNA or RNA by size and allows the visualization and purification of the amplified PCR products. We followed the Addgene's protocol "Agarose Gel Electrophoresis"

Details

Reagents and equipment

  • Agarose
  • TAE Buffer Solution (10x)
  • TAE Buffer Solution (1x)
  • Ethidium Bromide (EtBr)
  • dH2O
  • Casting tray
  • Well combs
  • Conical Flask
  • Pipette & tips
  • Weighing machine
  • Microwave
  • Voltage source
  • Gel box
  • UV light source
  • Electrophoresis device
Procedure

    Gel preparation 1% agarose
  1. Weigh 0.7 gr of agarose and place it in a flask.
  2. Mix agarose powder with 70ml 1x TAE .
  3. Microwave for 2-3 min until the agarose is completely dissolved.
  4. Let agarose solution cool down with cold water (for about 2 minutes under the tab).
  5. Add 4 μl ethidium bromide (EtBr).
  6. Place the well comb into a gel tray and pour the agarose into it.
  7. Let the gel at room temperature for 25 min, until it has completely solidified.
  8. Samples preparation and running the agarose gel
  9. Add 4 μl loading buffer 6X to each DNA sample (20 μl).
  10. Once the agarose gel is solidified, place it into the electrophoresis device.
  11. Fill the gel box with 1x TAE, until the agarose gel is covered.
  12. Load the DNA samples and 1 μl of a molecular weight ladder.
  13. Run the gel at 80-150 V for about 1 hour, depending on the gel concentration and voltage.
  14. Turn Off power and carefully remove the gel from the gel box.
  15. Visualize the DNA fragments, utilizing any UV light source.

Introduction

Golden Gate Assembly is a molecular cloning method that allows the simultaneous and directional assembling of multiple DNA fragments into a plasmid backbobe. We followed the “Golden Gate-based SevaBrick Assembly" method introduced by Stamatios G. Damalas.

Details

Reagents and equipment

  • BsaI HF v2
  • T4 ligase
  • T4 ligase Buffer
  • DpnI
  • BSA 20 mg/ml
  • Biobrick parts
  • Nuclease free water
  • Ice bucket filled with ice
  • Pipette & tips
  • Sterile PCR tubes
  • Thermocycler
Procedure

  1. Calculate DNA amounts and dilutions using an Excel file that is provided to the SEVA 3.1 paper. (See the link above)
  2. Prepare the Golden Gate Master Mix by adding the following components in a PCR tube and gently mix. For a 8 μl reaction, use 2 μl of Golden Gate Master Mix.
  3. BsaI HF v2 12 μl
    T4 ligase 10 μl
    T4 ligase Buffer 18 μl
    DpnI 1 μl
    BSA 20 mg/ml 1 μl
  4. Add the appropriate amounts of Golden Gate Master Mix and the DNA parts in a PCR tube and gently mix.
  5. Collect all liquid to the bottom of the tube by a quick spin if necessary.
  6. Introduce the PCR tubes in the thermocycler and use the following PCR protocol
  7. Cycles Temperature Time
    37oC 20 min
    X 30 16 oC 4 min
    37 oC 3 min
    50 oC 10 min
    80oC 10 min
    Hold 4-10 oC ∞

Introduction

3A Assembly ligation is a method for assembling two part samples and selecting for correct assemblies through antibiotics. We followed the 3A Assembly protocol introduced by iGEM Registry.

Details

Reagents and equipment

  • EcoRI-HF
  • SpeI
  • PstI
  • XbaI
  • DNA templates of the 2 parts and the plasmid backbone
  • NEB Buffer 2
  • dH2O
  • BSA
  • T4 DNA ligase Buffer
  • T4 DNA ligase
  • Ice bucket filled with ice
  • Pipette & tips
  • PCR tubes
  • Heating block machine
Procedure

    Digestion
  1. Restriction digestion of the two parts that will be assembled and the plasmid backbone. Add 4 μl of the linearized plasmid, Part A, Part B and 4 μl of the corresponding enzyme Master Mix.
  2. Enzyme M.M for Plasmid backbone Enzyme M.M for Part A Enzyme M.M for Part B
    5 μl NEB Buffer 2 5 μl NEB Buffer 2 5 μl NEB Buffer 2
    0.5 μl BSA 0.5 μl BSA 0.5 μl BSA
    0.5 μl EcoRI-HF 0.5 μl EcoRI-HF 0.5 μl XbaI
    0.5 μl PstI 0.5 μl SpeI 0.5 μl PstI
    0.5 μl DpnI
    18 μl dH2O 18.5 μl dH2O 18.5 μl dH2O
  3. Digest the 3 reactions at 37oC for 30 min
  4. Heat kill the restriction enzymes at 80oC for 20 min
  5. Ligation
  6. Add in a PCR tube all the components below.
  7. Plasmid backbone 2 μl
    Part A <3 μl equimolar to Part B
    Part B <3 μl equimolar to Part A
    T4 DNA ligase buffer 1 μl
    T4 DNA ligase 0.5 μl
    dH2O to 10 μl
  8. Place the tube at 16 oC for 30 min and then at 80 oC for 20 min.
  9. Transformation with 1-2 μl of ligation product into appropriate bacterial competent cells.

Introduction

Transformation is the process by which foreign DNA is introduced into a bacterial cell. In order to transform our E.coli competent cells with the desired plasmids we followed the “High Efficiency Transformation Protocol” from New England Biolabs.

Details

Reagents and equipment

  • LB agar plate (with appropriate antibiotic)
  • LB or SOC media
  • Competent cells
  • DNA you would like to transform
  • Shaking incubator at 37 °C
  • Stationary incubator at 37 °C
  • Ice bucket filled with ice
  • Microcentrifuge tubes
  • Sterile spreading device
  • Heating-block
Procedure

  1. Thaw a tube of competent E. coli cells on ice until the last ice crystal disappears.
  2. Mix gently and pipette 50 μl of cells into a transformation tube on ice.
  3. Add 1-5 µl containing 1 pg-100 ng of plasmid DNA to the cell mixture. Carefully flick the tube 4-5 times to mix cells and DNA. Do not vortex.
  4. Place the mixture on ice for 30 minutes. Do not mix.
  5. Heat shock at exactly 42°C for exactly 30 seconds. Do not mix.
  6. Place on ice for 5 minutes. Do not mix.
  7. Pipette 950 µl of room temperature SOC into the mixture.
  8. Place at 37°C for 60 minutes. Shake vigorously 250 rpm.
  9. Warm selection plates to 37°C.
  10. Mix the cells thoroughly by flicking the tube and inverting, then perform several 10-fold serial dilutions in SOC.
  11. Spread 50-100 µl of each dilution onto a selection plate and incubate overnight at 37°C.

Introduction

For the design of all the different single and double digestion that we performed, we used the NEB restriction digestion tools: “Heat Inactivation” and “NEBcloner”.

Details More...

Reagents and equipment

  • 10X rCutSmart Buffer
  • Appropriate restriction enzymes
  • Nuclease-free Water
  • DNA that will be digested
  • Ice bucket filled with ice
  • Pipette & tips
  • PCR tubes
  • Heating block machine
Procedure

Single digestion by SapI
  1. Set up reaction as follows:
  2. To 50 μl
    Component 50 μl Reaction
    DNA 1 μg
    10X rCutSmart Buffer 5 μl (1X)
    SapI 1.0 μl (10 units)
    Nuclease - free Water
  3. Incubate at 37 oC for 5-15 minutes.
  4. Incubate at 65 oC for 20 minutes for enzyme inactivation.
Double digestion
  1. Use NEBcloner to find the best conditions for the reaction according to the restriction enzymes.
  2. Add the reaction components in a sterile tube.
  3. Incubate at the best conditions according to NEBcloner.
  4. Incubate for enzyme inactivation according to the Heat Inactivation table.

DNA Isolation and Purification for cloning

Introduction

In order to isolate the plasmid DNA from liquid bacterial cultures, we used the NucleoSpin Plasmid kit for plasmid DNA isolation (Macherey-Nagel). We followed the protocol supplied with the kit by the manufacturer for isolation of high-copy plasmid DNA (pSB1C3) from E.coli.

Details

Reagents and equipment

  • Resuspension Buffer A1
  • Lysis Buffer A2
  • Neutralization Buffer A3
  • Wash Buffer AW
  • Wash Buffer
  • Elution Buffer AE
  • RNase A
  • Nucleospin® Plasmid Columns
  • Collection tubes
  • 96-100% ethanol
  • Pipette & tips
  • 1,5 ml microcentrifuge tubes
  • Manual pipettes
  • Microcentrifuge
  • Vortex mixer
  • Heating-block
Procedure

    Cultivate and harvest bacterial cells
  1. Use 1-5 mL of a saturated E.coli LB culture, pellet cells in a microcentrifuge for 30 s at 11,000 x g.
  2. Discard the supernatant and remove as much of the liquid as possible.
  3. Cell lysis
  4. Add 250 μL Buffer A1. Resuspend the cell pellet completely by vortexing. Make sure no cell clumps remain before addition of Buffer A2!
  5. Add 250 μL Buffer A2. Mix gently by inverting the tube 6–8 times. Incubate at room temperature for up to 5 min.
  6. Add 300 μL Buffer A3. Mix thoroughly by inverting the tube 6–8 times until blue samples turn colorless completely! Do not vortex to avoid shearing of genomic DNA!
  7. Clarification of lysate
  8. Centrifuge for 5 min at 11,000 x g at room temperature. Repeat this step in case the supernatant is not clear!
  9. Bind DNA
  10. Place a NucleoSpin® Plasmid/Plasmid (NoLid) Column in a Collection Tube (2 mL) and pipette a maximum of 700 μL of the supernatant from step 6 onto the column.
  11. Centrifuge for 1 min at 11,000 x g.
  12. Discard flowthrough and place the NucleoSpin® Plasmid/Plasmid (NoLid) Column back into the collection tube. Repeat this step to load the remaining lysate.
  13. Wash silica membrane
  14. Add 600 μL Buffer A4.
  15. Centrifuge for 1 min at 11,000 x g.
  16. Discard flowthrough and place the NucleoSpin® Plasmid / Plasmid (NoLid) Column back into the empty collection tube.
  17. Dry silica membrane
  18. Centrifuge for 2 min at 11,000 x g and discard the collection tube.
  19. Elute DNA
  20. Place the NucleoSpin® Plasmid / Plasmid (NoLid) Column in a 1.5 mL microcentrifuge tube and add 50 μL Buffer AE.
  21. Incubate for 1 min at room temperature.
  22. Centrifuge for 1 min at 11,000 x g.

Introduction

For the PCR clean-up of the PCR samples and the extraction of the DNA samples from agarose gel we used the NucleoSpin Gel and PCR Clean-up XS kit (Macherey-Nagel). We followed the protocol supplied with the kit by the manufacturer.

Details

Reagents and equipment

  • Binding Buffer NTI
  • Wash Buffer NT3
  • Elution Buffer NE
  • Nucleospin® Gel and PCR Clean-up XS columns
  • Collection tubes
  • 96-100% ethanol
  • Pipette & tips
  • 1,5 ml microcentrifuge tubes
  • Manual pipettes
  • Centrifuge for microcentrifuge tubes
  • Vortex mixer
  • Heating-block
  • Weighing machine
  • Scalpel to cut agarose gels
Procedure

    Before starting the preparation:
  • Ensure that ethanol was added to Wash Buffer NT3.
  • For gel extraction procedure, excise DNA band from agarose gel and determine the weight of the gel slice.
  • Preheat a heating block to 50 oC.

    Adjust DNA binding condition
  1. Mix 1 volume of sample with 2 volumes of Buffer NTI.
  2. Vortex
  3. Incubate mixture at 50°C with constant shaking until the gel is completely dissolved. (Only for agarose gel extraction)
  4. Bind DNA
  5. Place a NucleoSpin® Gel and PCR Clean-up XS Column into a Collection Tube (2 mL) and load up to 500 μL sample
  6. Centrifuge for 30 sec at 11,000 x g.
  7. Discard flowthrough and place the column back into the collection tube.
  8. If necessary, load the remaining sample and repeat steps 5,6.
  9. Wash silica
  10. Add 500 μL Buffer NT3 to the NucleoSpin® Gel and PCR Clean-up XS Column.
  11. Centrifuge for 30 sec at 11,000 x g.
  12. Discard flowthrough and place the column into a 1.5 mL microcentrifuge tube.
  13. Wash and dry silica
  14. Add 300 µL Buffer NT3 to the NucleoSpin® Gel and PCR Clean-up XS column.
  15. Centrifuge for 1 min at 11,000 x g.
  16. Discard flowthrough and place the column into a 1.5 mL microcentrifuge tube.
  17. Elution
  18. Add 6-12 µL Buffer NE and incubate at room temperature (18-25°C) for 1 min.
  19. Centrifuge for 1 min at 11,000 x g.
  20. Reload the eluates onto the column and repeat steps 14, 15.

In Vitro Transcription

Introduction

We used the HiScribe T7 High Yield RNA Synthesis kit for the in vitro transcription of crRNAs using T7 RNA Polymerase (New England Biolabs). We followed the protocol supplied with the kit by the manufacturer.

Details More...

Reagents and equipment

  • CTP
  • UTP
  • ATP
  • Template DNA
  • T7 RNA Polymerase Mix
  • GTP
  • 10X T7 Reaction Buffer
  • Nuclease - free microfuge tubes
  • Pipette & tips
  • Incubator
  • Centrifuge for microcentrifuge tubes
  • Ice bucket filled with ice
Procedure

    DNA template preparation - Plasmid template
  1. Linearization of the plasmid template, using the appropriate restriction enzymes
  2. Extract DNA with an equal volume of 1:1 phenol/chloroform mixture, repeat if necessary.
  3. Extract twice with an equal volume of chloroform to remove residual phenol
  4. Precipitate the DNA by adding 1/10th volume of 3 M sodium acetate, pH 5.2, and two volumes of ethanol. Incubate at -20°C for at least 30 minutes.
  5. Pellet the DNA in a microcentrifuge for 15 minutes at top speed. Carefully remove the supernatant.
  6. Rinse the pellet by adding 500 μl of 70% ethanol and centrifuging for 15 minutes at top speed. Carefully remove the supernatant.
  7. Air dry the pellet and resuspend it in nuclease-free water at a concentration of 0.5-1 μg/μl.
  8. RNA synthesis
  9. Thaw the necessary kit components, mix and pulse-spin in microfuge to collect solutions to the bottom of tubes. Keep on ice.
  10. If you are planning to run many reactions, it is convenient to prepare a master mix by combining equal volumes of the 10X reaction buffer and four ribonucleotide (NTP) solutions. Use 10 μl per reaction.
  11. Assemble the reaction at room temperature in the following order:
  12. Nuclease-free water X μl
    10X Reaction Buffer 2 μl
    ATP (100 mM) 2 μl 10 mM final
    GTP (100 mM) 2 μl 10 mM final
    UTP (100 mM) 2 μl 10 mM final
    CTP (100 mM) 2 μl 10 mM final
    Template DNA X μl 1 μg
    T7 RNA Polymerase Mix 2 μl
    Total reaction volume 20 μl
  13. Mix thoroughly, pulse-spin in microfuge.
  14. Incubate at 37°C for 2 hours. The yield will not be compromised if the incubation temperature is within the range of 35–40°C.
  15. Optional: DNase treatment to remove DNA template.
  16. Purification of synthesized RNA or analysis of transcription products by gel electrophoresis.

Introduction

For the purification of the RNA sample from in vitro transcription (IVT) we used the Monarch® RNA Cleanup Kit (New England BioLabs). We followed the protocol supplied with the kit by the manufacturer.

Details

Reagents and equipment

  • Monarch® RNA Cleanup Columns (500 μg)
  • Monarch® Collection Tubes II
  • Monarch® RNA Cleanup Binding Buffer
  • Monarch® RNA Cleanup Wash Buffer
  • Nuclease-free Water
  • 95-100% ethanol
  • Pipette & tips
  • 1,5 ml microcentrifuge tubes
  • Manual pipettes
  • Centrifuge for microcentrifuge tubes
  • Vortex mixer
  • Heating-block
Procedure

  1. Add 100 μl RNA Cleanup Binding Buffer to the 50 μl sample.
  2. A starting sample volume of 50 μl is recommended. For smaller samples, nuclease-free water can be used to adjust the volume. For samples larger than 50 μl, scale buffer volumes accordingly. Samples with a starting volume > 150 μl will require reloading of the column during Step 3.
  3. Add 150 μl of ethanol (≥ 95%) to your sample and mix by pipetting or flicking the tube. Do not vortex.
  4. Insert column into collection tube and load the sample onto column and close the cap.
  5. Centrifuge for 1 minute at 16,000 x g.
  6. Discard flow-through.
  7. Re-insert column into collection tube.
  8. Add 500 μl RNA Cleanup Wash Buffer
  9. Spin for 1 minute at 16,000 x g.
  10. Discard the flow-through.
  11. Repeat wash steps (Steps 6-9).
  12. Transfer column to an RNase-free 1.5 ml microfuge tube
  13. Elute in nuclease-free water 6-20 μl and spin for 1 min at 16,000x g .
  14. The eluted RNA can be used immediately or stored at -70oC

SUMO-LbuCas13a Expression and Purification

Reagents and equipment

  • LB-Medium
  • E.coli BL21 (DE3) Bacteria transformed with the final-T7-LbuCas13a plasmid
  • Chloramphenicol
  • Falcon tube 50ml
  • Pipette and tips
  • Shaking incubator
  • Waste filled with chlorine
Procedure

  1. Under sterile conditions, pour 15 ml of LB-Medium in the Falcon tube
  2. Thaw and add 7,5 μl Chloramphenicol
  3. Under sterile conditions pick with a tip enough bacteria
  4. Throw the tip into the falcon that contains the LB-Medium
  5. Place the falcon in a shaking incubator
  6. Grow the liquid culture overnight at 37 °C

Reagents and equipment

  • Sterile Flask 1000 ml with LB-Medium
  • Liquid bacterial pre-culture (15ml)
  • Chloramphenicol
  • IPTG
  • Incubator
  • Photometer
Procedure

  1. Under sterile conditions, pour 5 ml or more of the liquid bacterial pre-culture into the sterile Flask with 1000 ml LB-Medium, until the Optical Density (OD) is 0,1 units
  2. Add chloramphenicol and place the culture in the incubator at 37 oC
  3. Every 30 min measure the culture OD, until it reaches 0,5-0,6 units
  4. Add IPTG 1mM
  5. Place the culture again in the incubator at 37oC for the required hours depending on the experimental design.

Reagents and equipment

  • Binding buffer
  • Glycerol 100%
  • 5 Falcons (50 ml)
  • Refrigerated centrifugation
Procedure

  1. Divide the culture into 5 falcons
  2. Centrifuge for 13 min, 4000 rpm , at 4oC
  3. Discard the supernatant
  4. Repeat steps 1-3 until the 1000 ml culture finishes
  5. Add 23 ml Binding Buffer to one of the five falcons
  6. Vortex until the pellet is completely dissolved
  7. Pour the solution into the second falcon and repeat steps 6-7 until the solution is collected in a final falcon
  8. Add to the final falcon glycerol 100% up to 25 ml
  9. Vortex

Reagents and equipment

  • Falcon with the bacterial pellets
  • dH2O
  • Freezer approximately -60oC , -80 oC
  • Thermometer
Procedure

  1. Place the falcon in the freezer (-60oC, -80 oC) for 20 min
  2. Place a beaker with water on a heat source
  3. Place the falcon in it when the temperature reaches 42oC until the solution is thawed
  4. Repeat steps 1-3
  5. Store the falcon in the freezer ( -70oC )

Reagents and equipment

  • Falcon with the bacterial pellets after the freeze-thaw cycles.
  • Lysozyme 100 mg/ml
  • Triton X-100 280 μl
  • DNase 1 mg/ml
  • MgCl2 8 mM 2,4 ml
  • Protease Inhibitor (PI) 1x 260 μl
  • Refrigerator
  • Ultrasound sonication
  • Refrigerated centrifugation
  • Rotator machine
Procedure

  1. Thaw the falcon from the previous step
  2. Add 1 ml lysozyme
  3. Place the falcon in the refrigerator for 30 min
  4. Add 280 μl triton x-100
  5. Place it on ice
  6. Sonication 30 sec, ice 1 min
  7. Repeat step 6, 13 times
  8. Add 560 μl DNase, 2,4 ml MgCl2 , 260 μl PI
  9. Incubate the sample in a cold room for 2 hours using rotator machine
  10. Centrifuge for 20 min, 14000 rpm , at 4oC
  11. Discard the supernatant
  12. Store the pellets at -20oC

Reagents and equipment

  • Falcon that contains the lysed Inclusion Bodies
  • Buffers A, B, C
  • Protease Inhibitor (PI) 1x
  • L-Arg
  • Refrigerator
  • Refrigerated centrifugation
  • Rotator machine
  • Weighing Machine
Procedure

  1. Take out of the freezer the falcon of the previous step
  2. Centrifuge for 5 min , 10000 rcf at 4oC
  3. Discard the supernatant, if exists
  4. Weigh the falcon and calculate the quantity of Buffer A and PI that is needed
  5. Add Buffer A and PI and dissolve completely
  6. Rotation in the refrigerator for 30 min
  7. Centrifuge for 20 min , 15000 rcf at 4oC
  8. Discard the supernatant
  9. Weigh the falcon and calculate the quantity of Buffer B and PI that is needed
  10. Add Buffer B and PI and dissolve completely
  11. Rotation in the refrigerator for 15 min
  12. Centrifuge for 15 min , 15000 rcf at 4oC
  13. Discard the supernatant
  14. Weigh the falcon and calculate the quantity of Buffer C and PI that is needed
  15. Rotation in the refrigerator for 5 min
  16. Centrifuge for 5 min , 6000 rcf at 4oC
  17. Discard the supernatant
  18. Steps 1-17 take place on ice
  19. Add 800 μl L-Arg and dissolve
  20. Centrifuge for 5 min , 4000 rcf at room temperature
  21. Collect the supernatant on another falcon and store (1st spin)
  22. Repeat steps 19-20
  23. Collect the supernatant on another falcon and store (2nd spin)
  24. Under sterile conditions, filter the 1st and 2nd spin with 45 mm filter
  25. Store the falcons at room temperature

Reagents and equipment

  • Cytiva His-trap column kit
  • Cytiva His-trap buffer kit
  • SUMO-LbuCas13a protein
  • Centrifuge machine
Procedure

    Note All centrifugations were performed at 2500g for 1min at Room Temperature

  1. Removal of column's storage buffer by centrifugation (discard the flowthrough).
  2. Equilibration of the His-trap column by adding 600μl binding buffer of 20mM imidazole and centrifuge (discard the flowthrough).
  3. Place 600μl of the sample to the column (protein binding to the matrix) and centrifuge (discard the flowthrough).
  4. Repeat step 3 until the column's capacity is reached.
  5. Perform 3 washing steps using binding buffers of 40 mM imidazole, 80mM imidazole and 100mM imidazole (centrifuge and discard the flowthrough).
  6. Addition of 200mM elution buffer containing 500mM of imidazole (centrifuge and store the flowthrough)
  7. Repeat step 6.

Reagents and equipment

  • 100 μl template (protein of interest)
  • 20 μl SUMO protease buffer
  • 10 μl ULP1 protease
  • Up to 200 μl DEPC H2O
  • Pipette & tips
  • Sterile tubes
  • Heat block machine
Procedure

  1. Add all the reagents in a tube
  2. Incubate for 2 hours at 37 oC

Reagents and equipment

  • Bis-acrylamide 30%
  • Tris-HCl 1M PH 8,80
  • Tris-HCl 1M PH 6,8
  • APS 10%
  • TEMED
  • Loading Dye 5X
  • Running Buffer
  • 2-Propanol
  • SDS 10%
  • dH2O
  • Protein marker
  • Coomassie blue staining
  • Electrophoresis apparatus
  • Glass cast
  • Cast stand
  • Thermoblock
Procedure

    Gel preparation
  1. Glass cast assembly
  2. Build the separating phase and fill in the glass cast compartment
  3. Add 2-propanol on top 1ml
  4. Wait for 1 hour and 30 min for the gel to polymerize
  5. Wash out the 2-propanol using dH2O
  6. Dry the compartment between the glasses
  7. Create the stacking phase and add it to the cast
  8. Wait about 1 hour and 30 min for the gel to solidify
  9. Sample preparation
  10. For every 30 μl of sample add 7,5 μl of loading dye 5X
  11. Boil the sample for 10 min at 95oC using a Thermoblock
  12. Running of the polyacrylamide gel
  13. Assembly the electrophoresis apparatus
  14. Add the running buffer
  15. Load the sample (30 μl max) and the protein marker (4 μl)
  16. Start the electrophoresis at 80 V for 30 min and then raise the value at 140 V for 1h
  17. Remove the gel from the cast and put it in staining or use it for Western Blot

Reagents and equipment

  • Transfer Buffer (cold)
  • PBST Buffer
  • Methanol
  • Blocking Buffer
  • Primary antibody Anti- His Santa Cruz 1:2000 ( 4 ml PBST, 3% milk, 2 μl antibody)
  • Alkaline phosphatase buffer
  • NBT solution
  • BCIP solution
  • Western blot apparatus
  • PVDF membrane
  • Whatman filter papers
  • Gel from SDS electrophoresis
  • Stirring machine
  • Rocking machine
Procedure

  1. Soak the cassette pads in the transfer buffer.
  2. Wet the membrane with methanol for 1 min to activate it and place it in the transfer buffer.
  3. Cut 4 whatman filter papers and place them in the transfer buffer.
  4. Remove gel from cast and leave it in the transfer buffer.
  5. Assembly of cassette : place a pad, two whatman papers and on top of them the gel. Put the membrane on top of the gel plus two more whatman papers and another pad (leave out all air bubbles). Close the cassette and place it in the apparatus and fill up with transfer buffer. Add a magnet for stirring and ice if desired.
  6. Transfer in the cold room (4oC) for 2 h at 100V, 0,3A.
  7. Remove membrane and place it in blocking buffer for 1h and 30 min on the rocker machine.
  8. Remove the blocking buffer and place the membrane in the primary antibody solution and leave it at 4 oC overnight.
  9. The next day remove the primary antibody and perform four PBST washes of 5 min each (5ml per membrane, rocker machine).
  10. Add the secondary antibody solution and place it on the rocker machine for 1h and 20 min.
  11. Remove the secondary antibody and perform again four PBST washes of 5 min each (5 ml per membrane, rocker machine).
  12. Start a new set of four washes using AP buffer (5 ml per membrane, rocker machine).
  13. Add 4 ml AP buffer to the membrane plus 13,3 μl BCIP and 17,6 μl NBT (rocker machine).
  14. Wait for the bands to appear.

Cell culturing and RNA isolation

Reagents and equipment

  • Cell culture vessel
  • DMEM High Glucose (4.5 g/l), with L-Glutamine, without Sodium Pyruvate
  • 0.25% (w/v) Trypsin- 0.53 mM EDTA solution
  • Fetal bovine serum (FBS)
  • Penicillin-Streptomycin (10.000 U/mL)
  • PBS 1X
  • 75% ethanol
  • Serological pipettes
  • Pipette & tips
  • Microcentrifuge
  • Fume hood
  • Tissue cell culture dishes
Procedure

    Initiating frozen cultures
  1. Prepare a culture vessel so that it contains the recommended volume of the appropriate culture medium as listed on the Product Sheet, equilibrated for temperature and pH (CO2).
  2. Thaw the vial by gentle agitation in a water bath at 37°C or the normal growth temperature for that cell line. Thawing should be rapid, approximately 2 minutes or until ice crystals have melted.
  3. Remove the vial from the water bath and decontaminate it by dipping in or spraying with 70% ethanol. Follow strict aseptic conditions in a laminar flow tissue culture hood for all further manipulations.
  4. Unscrew the top of the vial and transfer the contents to a sterile centrifuge tube containing 9 mL of the recommended medium. Remove the cryoprotectant agent (DMSO) by gentle centrifugation (10 minutes at 125 × g). Discard the supernatant, and resuspend the cells in 1 or 2 mL of complete growth medium. Transfer the cell suspension into the culture vessel containing the complete growth medium and mix thoroughly by gentle rocking.
  5. Examine the cell cultures after 24 hours and subculture as needed.
    Subculturing procedure
  1. Remove and discard culture medium.
  2. Briefly rinse the cell layer with 0.25% (w/v) Trypsin- 0.53 mM EDTA solution to remove all traces of serum which contains trypsin inhibitor.
  3. Add 2.0 to 3.0 mL of Trypsin-EDTA solution to flask and observe cells under an inverted microscope until the cell layer is dispersed (usually within 5 to 15 minutes).
    Add 6.0 to 8.0 mL of complete growth medium and aspirate cells by gently pipetting.
  4. Add appropriate aliquots of the cell suspension to new culture vessels.
  5. Incubate cultures at 37°C.
We followed a subcultivation ratio of 1:2 to 1:5 and the medium was changed every 2 days.

Introduction

In order to extract and purify the total RNA from the A549 and MRC5 cell lines we used the RNeasy Micro Kit (Qiagen Inc.) We followed the protocol supplied with the kit by the manufacturer.

Details

Reagents and equipment

  • Cell culture vessel
  • DMEM High Glucose (4.5 g/l), with L-Glutamine, without Sodium Pyruvate
  • 0.25% (w/v) Trypsin- 0.53 mM EDTA solution
  • Fetal bovine serum (FBS)
  • Penicillin-Streptomycin (10.000 U/mL)
  • PBS 1X
  • 75% ethanol
  • Serological pipettes
  • Pipette & tips
  • Microcentrifuge
  • Fume hood
  • Tissue cell culture dishes
  • RNeasy Micro Kit (Qiagen Inc.)
  • RNase free microcentrifuge tubes
  • Pipette & tips
  • Fume hood
Procedure

    Cell seeding and detaching
  1. The cells were seeded in 6-well plate at a density of 0.3 x 10 6 in high glucose Dulbecco’s modified Eagle Medium (DMEM), supplemented with 10% FBS and 1% PS and incubate at 37oC, 5% CO2
  2. When the cells reached at about 80% confluency, were detached with Trypsin-EDTA solution, washed with PBS 1X and the total number of cells was estimated using a Neubauer chamber.
  3. 5X105/per cell line were used as the starting material for the RNA isolation procedure utilizing the RNeasy Micro Kit (Qiagen Inc.)
  4. RNA isolation
  5. Add 10 μl β-mercaptorthanol (β-ME) to 1 ml Buffer RLT before use. Store at room temperature.
  6. The cells suspension was centrifuged at 1200xg for 5 minutes to collect the cell pelet
  7. Add 350 μl Buffer RLT and homogenize.
  8. Add 1 volume of 70% ethanol to the lysate and mix well by pipetting. Do not centrifuge! Proceed immediately to the next step!
  9. Transfer the sample to a RNeasy MinElute spin column in a 2 ml collection tube. Close the lid and centrifuge for 15 sec at ≥8000 x g. Discard the flow-through.
  10. Add 350 µl Buffer RW1 to the RNeasy MinElute spin column. Close the lid. Centrifuge for 15 s at ≥8000 x g. Discard the flow-through.
  11. Add 10 µl DNase I stock solution to 70 µl Buffer RDD. Mix by inverting the tube. Add the DNase I incubation mix (80 µl) directly to the RNeasy MinElute spin column membrane. Place on the benchtop (20–30°C) for 15 min.
  12. Add 350 µl Buffer RW1 to the RNeasy MinElute spin column. Close the lid, and centrifuge for 15 sec at ≥8000 x g. Discard the collection tube.
  13. Place the RNeasy MinElute spin column in a new 2 ml collection tube.
  14. Add 500 µl Buffer RPE to the spin column. Close the lid, and centrifuge for 15 sec at ≥8000 x g. Discard the flow-through
  15. Add 500 µl of 80% ethanol to the RNeasy MinElute spin column. Close the lid, and centrifuge for 2 min at ≥8000 x g. Discard the collection tube.
  16. Place the RNeasy MinElute spin column in a new 2 ml collection tube. Open the lid of the spin column, and centrifuge at full speed for 5 min to dry the membrane. Discard the flow-through and collection tube.
  17. Place the RNeasy MinElute spin column in a new 1.5 ml collection tube. Add 14 µl RNase-free water directly to the center of the spin column membrane. Close the lid gently, and centrifuge for 1 min at full speed to elute the RNA.

Microfluidics

Reagents and equipment

  • DLP 3D printer
  • Resin
  • Isopropyl alcohol
  • Syringe pumps
Procedure

  1. Design the 3D model of the appropriate microfluidic device through a Computer-Aided Design.
  2. Export the STL file of the device
  3. Use the STL file as an input to the according slicing software of the DLP 3D printer.
  4. Slice the model with layer height of 0.05 mm and Time exposure 40 seconds for every layer.
  5. Fill the resin vat with the resin of your choice.
  6. Start the printing process.
  7. Remove the device from the platform.
  8. Clear the microfluidic channels with isopropyl alcohol.
  9. Ready for testing!

CRISPR/Cas13a bulk fluorescence experiments

Reagents and equipment

  • PBS 1X
  • 75% ethanol
  • Serological pipettes
  • Pipette & tips
  • Fume hood
  • RNase free microcentrifuge tubes
  • Pipette, tips & falcon tubes
  • Microcentrifuge
  • 96-well black microplate (Greiner Bio-one)
  • Fluorescence microplate reader
Procedure

Step 1 (RS mixture preparation)

The RS reaction mix contains the reagents that are shown in the following table in a final volume of 30μl. The RS mixture is prepared by adding the same volume of RNA reporter, a specified amount of total RNA sample extracted by each cell line according to the RNeasy Micro Kit (Qiagen Inc.), reaction buffer 5X and water. For estimating the miRNA levels in RNA samples isolated from 2 different cell lines, 2 RS mixtures should be prepared each having the corresponding RNA sample.


RS mixture (1 for each cell line)
Reagent Quantity μl (for 20μl mix) Multiply by the number of technical replicates (e.g. 4)
Reporter 5μM 10 40
RNA sample (83.3ng) 10 40
Reaction Buffer 5X 6 24
Water 4 16
Step 2 (CC reaction mixture preparation)

The CC reaction mix contains the reagents that are shown in the following table in a final volume of 20μl.

CC mixture
Reagent Quantity μl (for 20μl mix) X number of total samples (e.g. 2 cell lines X 4 replicates/ cell line =8)
LbuCas13a 2pmol/μl 0.5 4
crRNAx 100nM 10 80
Reaction Buffer 5X 4 32
Water 5.5 44
Step 3 (microplate preparation)

20μl of the RS mix corresponding to the same cell line is added on the specified wells of the microplate, followed by the addition of 30μl of the CC reaction mixture. The mixture is pipetted up and down several times and the enzyme reaction starts.

The above procedure is repeated for all the different RS mixtures which correspond to the RNA extracts isolated from different cell lines.

Step 4 (fluorescence measurement)

The plate is inserted into the appropriate fluorescence plate reader and the fluorescence detection should be conducted within the first 5 minutes after reaction initiation for best results.

Reaction Buffer 5X for Cas13a/crRNA assays
Component Concentration
Tris HCl 10mM
KCl 50mM
MgCl2 1.5mM
pH 8.3

Solutions Preparation


Reagents and equipment

  • 99% glycerol
  • dH2O
  • Duran bottle
  • Serological pipette
Procedure

  1. Add 1 part 99% glycerol in a sterile bottle
  2. Add 1 part of sterile H2O and mix until the glycerol is completely dissolved
  3. Autoclave the solution

Reagents and equipment

  • 48.5 g Tris Base
  • 11.4 mL glacial acetic acid
  • 20 mL 0.5M EDTA (pH 8.0)
  • Duran bottle
  • Weighing machine
Procedure

  1. Dissolve Tris in about 800 mL of deionized water
  2. Add acetic acid and EDTA
  3. Add deionized water to a final volume of 1L
  4. Sterilize by autoclaving
  5. Store at room temperature

Reagents and equipment

  • 14,4 ml chloroform
  • 600 μl isoamyl alcohol
  • Duran bottle
  • Fume hood
Procedure

  1. Mix the two solutions
  2. Store at 4oC

Reagents and equipment

  • 80 gr NaCl
  • 2 gr KCl
  • 14.4 gr Na2HPO4
  • Up to 1 L dH2O
  • Duran bottle
  • Weighing machine
  • Autoclave
  • pH meter
Procedure

  1. Weigh the appropriate quantities of solid ingredients
  2. Dissolve the reagents in dH2O
  3. Adjust pH to 7.4
  4. Sterilize by autoclaving
  5. Store at Room Temperature

Reagents and equipment

  • 1.5 ml NaCl 5M
  • 0.5 ml SDS 10%
  • 5 ml Nonidet P-40 10%
  • 0,5 g Deoxycholic acid sodium salt
  • 0.5 ml Sodium phosphate pH 7.2
  • Duran bottle
  • Weighing machine
  • Autoclave
Procedure

For 1L solution
  1. Add all the solutions in a Duran bottle
  2. Weigh 0.5 Deoxycholic acid sodium salt and add it to the bottle
  3. Mix until complete dissolve
  4. Sterilize by autoclaving
  5. Store at 4oC

Reagents and equipment

  • 116,8 g Acrylamide
  • 3.2 g Bis
  • Up to 400 ml dH2O
  • Sterile Duran bottle
  • Weighing machine
  • Protective mask
Procedure

For 400 ml solution
  1. Weigh the appropriate amounts of solid ingredients
  2. Dissolve them in about 400 mL of dH2O in a Duran bottle
  3. Heat the solution for complete dissolve if it is needed
  4. Store at 4oC

Reagents and equipment

  • 0.1 g APS
  • Up to 1 ml dH2O
  • Sterile falcon
  • Weighing machine
  • Protective mask
Procedure

For 1 ml solution
  1. Weigh the 0.1 g of APS
  2. Dissolve it in 1 mL of dH2O
  3. Store at 4oC

Reagents and equipment

  • 2 ml Tween 10% solution
  • 198 ml PBS 1x solution
  • Sterile Duran bottle
Procedure

For 200 ml solution
  1. Add the solutions in a Duran bottle and mix
  2. Store at Room temperature

Reagents and equipment

  • 300 ml Methanol
  • 100 ml Acetic acid
  • Up to 1000 ml dH2O
  • Sterile Duran bottle
Procedure

For 1L solution
  1. Add the solutions in a Duran bottle and mix
  2. Add up to 1000 ml dH2O and dissolve
  3. Store at Room temperature

Reagents and equipment

  • 2,613 g L-arginine
  • 1,2 ml Tris-HCl 1M pH: 7,6
  • Up to 30 ml dH2O
  • Sterile Duran bottle
  • Weighing machine
  • pH meter
Procedure

For 30 ml solution 0.5M
  1. Weigh L-Arginine and dissolve it to Tris-HCl
  2. Add up to 30 ml dH2O and dissolve
  3. Adjust the pH to 7.0
  4. Store at Room temperature

Reagents and equipment

  • 0,463 g DDT
  • Up to 1 ml dH2O
  • Sterile tube
  • Weighing machine
Procedure

For 1 ml solution 3M
  1. In a tube weigh 0,463 g DTT
  2. Add up to 1 ml dH2O and dissolve
  3. Store at - 20oC

Reagents and equipment

  • 2,383 g IPTG
  • Up to 10 ml dH2O
  • Sterile falcon
  • Filter 0,22 μm
  • Weighing machine
Procedure

For 10 ml solution 1M
  1. In a falcon weigh 2,383 g IPTG
  2. Dissolve IPTG in 8 ml dH2O
  3. Add up to 10 ml dH2O
  4. Filter the solution using a 0,22 μm filter
  5. Store at - 20oC

Reagents and equipment

  • 10 mg Lysozyme
  • Up to 1 ml Glycerol
  • Sterile tubes
  • Filter 0,22 μm
  • Weighing machine
Procedure

For 10 ml solution 1M
  1. In a tube weigh 10 mg Ly-ozy me
  2. Add up to 8 ml dH2O and dis-olv e
  3. Filter the solution using a 0,22 μm -ilt er
  4. Store at - 20oC

Reagents and equipment

  • 75 mg NBT
  • 0,7 ml 70% v/v DMF
  • Sterile tubes
  • Weighing machine
Procedure

For 0,7 ml solution
  1. In a tube weigh 75 mg NBT
  2. Add 0,7 ml DMF and dissolve
  3. Store at - 20oC

Reagents and equipment

  • 50 mg BCIP
  • 1 ml 100% DMF
  • Sterile tubes
  • Weighing machine
Procedure

For 1 ml solution
  1. In a tube weigh 50 mg BCIP
  2. Add 1 ml DMF and dissolve
  3. Store at - 20oC

Reagents and equipment

  • 60 ml Tis-HCl 1M
  • 12 ml NaCl 5M
  • 30 ml MgCl2
  • Up to 600 ml dH2O
  • Sterile Duran bottle
  • pH meter
Procedure

For 600 ml solution
  1. Add the reagents in a Duran bottle and mix
  2. Adjust pH to 9,5
  3. Store at Room Temperature

Reagents and equipment

  • 186.1 g disodium EDTA
  • Up to 1000 ml dH2O
  • Duran bottle
  • pH meter
  • Weighing machine
  • Autoclave
Procedure

For 1L solution 0,5M (pH 8.0)
  1. In a Duran bottle weigh 186.1 g disodium EDTA
  2. Add dH2O up to 1000 ml and adjust the pH to 8
  3. Stir vigorously on a magnetic stirrer
  4. Sterilize by autoclaving
  5. Store at Room Temperature

Reagents and equipment

Buffer A Buffer B Buffer C
50 mM Tris-HCl pH 8.0 50 mM Tris-HCl pH 8.0 50 mM Tris-HCl pH 8.0
100 mM NaCl 100 mM NaCl 100 mM NaCl
1 mM EDTA 1 mM EDTA 1 mM EDTA
0,1% sodium deoxycholate DOC 1% Nonidet P-40 -
Up to 200 ml dH2O Up to 100 ml dH2O Up to 100 ml dH2O
Duran bottle Duran bottle Duran bottle
Weighing machine Weighing machine Weighing machine
Procedure

1. Add all the solutions in a Duran bottle and mix
2. Add the appropriate amount of dH2O
3. Store at Room Temperature

Reagents and equipment

  • 1.25 ml Tris-HCl 1M pH 6.8
  • 0.5 g SDS 10%
  • 0.0063 g Bromophenol Blue
  • 2.5 ml glycerol 10%
  • Up to 5 ml dH2O
  • Sterile falcon
  • Weighing machine
Procedure

  1. Weigh the solid ingredients
  2. Add all the reagents in a sterile falcon
  3. Add dH2O up to 1000 ml and dissolve
  4. Store at 4oC

Reagents and equipment

  • 100 ml Transfer buffer 10X (Glycine & Tris-Base)
  • 200 ml Methanol
  • Up to 1000 ml dH2O
  • Sterile Duran bottle
Procedure

For 1L solution
  1. Add all the reagents in a Duran bottle
  2. Add dH2O up to 1000 ml and mix
  3. Store at 4oC

Reagents and equipment

  • 180 ml Methanol
  • 40 ml Acetic acid
  • 400 mg Coomassie BB-R
  • Up to 400 ml dH2O
  • Sterile Duran bottle
  • Weighing machine
Procedure

For 400 ml solution
  1. Weigh the Coomassie
  2. Add and mix all the reagents in a sterile Duran bottle
  3. Add dH2O up to 400 ml and dissolve
  4. Store at Room temperature

Reagents and equipment

  • 14.4 g Glycine
  • 3 g Tris-Base
  • 1 g SDS
  • Up to 1000 ml dH2O
  • Sterile Duran bottle
  • Weighing machine
Procedure

For 1L solution
  1. Weigh the solid ingredients
  2. Dissolve glycine and Tris-Base in 800 ml dH2O
  3. Add SDS and dissolve
  4. Add dH2O up to 1000 ml and dissolve
  5. Store at Room temperature

Primer Sequences


Primer Name Primer Sequence
cas13a P1 FWD aGGTCTCGGAATTCGCGGCCGCTTCTAGatgggcagcagccatc
cas13a P1 RVS aGGTCTCagctcCtctttgtccaggtagtacttg
cas13a P2 FWD aGGTCTCagagcttaatgacaagaacatcaaatatg
cas13a P2 RVS aGGTCTCttcagttggcgaaagattttcag
cas13a P3 FWD aGGTCTCactgaaCtctgcgaatgtcttccgttatc
cas13a P3 RVS aGGTCTCaatgcgcagcaacagaccttgcagcagatttaactcgttAaattcaaccttgtttttgagatg
cas13a P4 FWD aGGTCTCcgcattcttcaccgtttagttggttatacgagcatttgggaaCGCgacctgcgttttcgtctg
cas13a P4 RVS aGGTCTCGACTGCAGCGGCCGCTACTAGTAttattaattctcgcttttcttctcttcc
SUMOLESS FWD aGGTCTCcatgaaagtcaccaaagtgggtg
SUMOLESS RVS aGGTCTCttcatgccgctgctgtgatg
cas13a T7 P0 FWD aGGTCTCGGAATTCGCGGCCGCTTCTAGAGttattactgcccgctttccag
cas13a T7 P0 RVS aGGTCTCctagTggggaattgttatccgctc
cas13a T7 P1 FWD aGGTCTCtactagaaataattttgtttaactttaagaaggag
cas13a P1b FWD aGGTCTCaTACCatgggcagcagccatc
Pv aGGTCTCacagtccggcaaaaaaggg
Ev ccgGGTCTCaattccagaaatcatccttagcgaaagc
cas13a RBS FWD aGGTCTCtactagagaaagaggagaaatactagatgggcagcagccatc
VF 2 TGCCACCTGACGTCTAAGAA
VR ATTACCGCCTTTGAGTGAGC
Ep agctttcgctaaggatgatttctGGTCTCggaattcgcg
Pp accttgcccttttttgccGGTCTCgactgcagcg
Sp cccttttttgccggactgcagcggccgctaGGTCTCcTAGTa
Xp ggatgatttctggaattcgcggccGGTCTCtACTAga
OP1 cgctaaggatgatttctggaattcgcaggccgcttggtctcaactagagaaagaggagaaatactagatg
Prham.Brk-F aggtctctgaattcgcggccgcttctagagttattaatctttctgcgaattgag
Prham.Brk-R aggtctcgactgcagcggccgctactagtattcattacgaccagtctaaaaag

Primer Name Primer Sequence
Loop RVS standard aGGTCTCaTTAGTCCCCTTCATTTTTGGGGTGGTCCTATAGTGAGTCGTATTACTCTAGAAGCGGCCGCGAATTC
3ps spacer FWD interchangeable aGGTCTCACTAAAACTACAAGTGCCTTCACTGCAGAGAAGAGCTACTAGTAGCGGCCGCTGCAG
3pm spacer FWD interchangeable aGGTCTCACTAAAACTACAAGTGCCTTCACAGCAGAGAAGAGCTACTAGTAGCGGCCGCTGCAG
3pe spacer FWD interchangeable aGGTCTCACTAAAACTACAAGTGCCTTCACTGCAGAGTGAAGAAGAGCTACTAGTAGCGGCCGCTGCAG
5ps spacer FWD interchangeable aGGTCTCACTAAAACCCTGCACTGTAAGCACTTTGAGAAGAGCTACTAGTAGCGGCCGCTGCAG
5pm spacer FWD interchangeable aGGTCTCACTAAAACCCTGCACTGTAAGCAGTTTGAGAAGAGCTACTAGTAGCGGCCGCTGCAG
5pe spacer FWD interchangeable aGGTCTCACTAAAACCCTGCACTGTAAGCACTTTGGTGCTAGAAGAGCTACTAGTAGCGGCCGCTGCAG
Loop FWD standard aGGTCTCaGAAGATCCTTTGATCTTTTCTACGGGGTCTG

Cloning Strategy


A Golden Gate-based cloning pipeline for the construction of our final constructs.

Introduction

A fundamental goal of our project design is to construct functional genetic elements in accordance with the principles of standardization, interchangeability and modularity. Synthetic biology engineering approaches are based on a combination of multiple genetic elements that can be easily interchanged between biological systems to provide new capabilities and applications. In this context, we designed and constructed all our genetic elements in accordance with the BioBrick RFC[10] standard. Our genetic parts are flanked by the prefix and suffix sequence at the beginning and the end of the part respectively enabling the easy interchangeability of the genetic sequences utilizing standard cloning methods. The restriction sites that also appear at the prefix and suffix and could interfere with the assembly methods have been successfully removed from the inserted sequences with mutagenesis PCR. Considering that the iGEM registry uses pSB1C3 high copy number plasmid as its shipping standard, we cloned all our parts in pSB1C3 before admission to the registry.

Golden Gate-based "SevaBrick Assembly" method.

Given its advantages and as we were attempting to clone multiple inserts for protein fusion constructs in the pSB1C3 plasmid backbone, the Golden Gate-based "SevaBrick Assembly" method introduced by Stamatios G. Damalas and colleagues[seva 3.1] as the primary cloning method for our project (Damalas et al., 2020). This method consists of standardized primers and protocols and facilitates the straightforward one-step assembly of multiple genetic elements into the SEVA 3.1 or the pSB#X# (# is determined by the identity of the replication origin and the letter X is determined by the antibiotic resistance marker) backbones in a fast and reliable process. The SevaBrick Assembly is a method where all the parts and backbones to be assembled are PCR amplified from any SEVA 3.1 or BioBrick vector, using a core set of standard long primers. All SevaBrick primers anneal on standard sequences of the SEVA 3.1 or BioBrick vectors, introducing BsaI recognition sites for directional multipart assembly via Golden Gate (Figure 1).

Graphical overview of the SevaBrick Assembly. Inserts and backbones are amplified using a core set of standard primers which introduce compatible Bsal sites, allowing the construction of expression vectors with varying degrees of complexity via Golden Gate (Figure modified from Damalas et al., 2020).

The majority of our parts were large in kb and thus the Gibson Assembly was inappropriate for our cloning strategy. In contrast to Gibson assembly which requires three different enzymes and can be challenging, the Golden Gate-based cloning method that we followed requires only a type II S restriction enzyme and a DNA ligase for the efficient assembling of genetic sequences. However, the tremendous advantage of this method is that it is typically performed as an all-in-one-pot reaction minimizing handling time and maximizing cloning efficiency. Specifically, the properly designed DNA parts, the type II S restriction enzyme and a DNA ligase are mixed in a PCR tube and placed in a thermocycler. The DNA elements get digested due to restriction enzyme functionality and are ligated by the DNA ligase. This process is repeated over and over again and the elements are forming the desired products since the properly assembled parts lack the restriction sites that exist at the unincorporated DNA parts.

Utilizing the Golden Gate-based "SevaBrick Assembly" method in combination with additional proprietary primers and method modifications, we have successfully assembled all our basic parts such as protein-coding sequences, into the pSB1C3 plasmid backbone. Using this methodology we succeed in the proper assembly of 5 different parts at the desired vector on the first try and with the least possible waste of valuable time. All our parts are compatible with the BioBrick RFC[10] standard facilitating their incorporation into complicated genetic devices and composite parts. The pSB1C3 plasmids with integrated coding sequences of our basic parts are called Repository (Repos) plasmids for convenience. Specific details regarding the description and the individual cloning process that we followed for the assembling of our final constructs are described below.