Part Collection

BBa_K4219000

Part Type: Coding.

Short Description: Evolutionary-stabilized optimized GFP reporter protein.

Long Description: This part is an optimized version of the BBa_K079050 construct. Our team optimized the old part and constructed the new one while utilizing the ESO software (Menuhin et al, 2022). The ESO is a software constructed by TAU IGEM team 2020 as part of their project, and we used this software with their help and under their guidance. The software optimizes the evolutionary stability of a given DNA construct, by preventing sites that are prone to mutation and recombination while preserving the amino acid sequence. While designing this new part, the goal stood in front of our eyes was to induce minimal changes, so the functionality of the initial construct will be preserved, while the evolutionary stability of the construct greatly elevated. This was verified by an iab evolution experiment, (please refer to the “improvement of an existing part” page for further details). The users of that part should address it exactly the same as they were addressing the original one – use it as a GFP protein constituting a DNA damage reporter – while taking into account that it is evolutionary-stabilized, namely will preserve its functionality for a longer period of time.

Design Considerations: The sequence of this part was determined by utilizing the ESO software, developed by 2020 TAU IGEM team. The software changes the DNA sequence in order to prevent sites that are prone to mutation or recombination while preserving the amino acid sequence. Our team created two variations of each part, one that only optimized the evolutionary stability of the construct, and a second one that also optimized the sequence for E.coli expression (codon usage optimization; for further information please refer to the “improvement of an existing part” page). Our team manually checked the work of the algorithm by MSA, to verify that indeed the amino acid sequence was preserved.

Sequence (of the fully-optimized version, including codon bias optimization):

GAATTCGCGGCCGCTTCTAGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGCTGTATGAGCATACAGTACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGTGAAGAATTATTCACTGGCGTGGTCCCTATCCTGGTTGAATTAGATGGTGATGTGAATGGGCACAAATTCTCTGTCAGTGGTGAGGGTGAGGGTGATGCAACCTACGGCAAACTGACCCTGAAATTTATTTGTACGACGGGCAAACTCCCGGTTCCATGGCCAACACTGGTCACGACCTTCGGTTATGGTGTTCAGTGCTTTGCGCGGTATCCGGATCATATGAAACAGCATGACTTTTTCAAAAGCGCCATGCCGGAAGGTTATGTACAGGAGCGTACTATATTTTTCAAAGATGACGGCAACTACAAGACCCGTGCTGAAGTGAAGTTTGAAGGAGATACCCTTGTTAATCGAATCGAGTTGAAAGGGATTGATTTTAAGGAAGATGGAAACATTCTCGGCCACAAATTGGAATACAATTATAACTCACATAATGTGTACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATCCGCCACAACATTGAAGATGGCAGCGTACAGCTGGCCGACCATTATCAGCAAAATACGCCGATTGGCGATGGCCCGGTCCTACTGCCGGACAACCATTACCTGTCCACCCAAAGCGCCCTGTCGAAAGATCCCAACGAAAAGCGCGACCACATGGTGCTGCTTGAGTTTGTAACCGCTGCGGGGATTACCCATGGCATGGATGAACTGTATAAACGCCCTGCGGCGAACGACGAAAATTATGCGTTAGTGGCATAATGATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAG

Length: 1024 base pairs.

BBa_K4219001

Part Type: Coding.

Short Description: Evolutionary-stabilized optimized eCFP coding device.

Long Description: This part is an optimized version of the BBa_J04421 construct. Our team optimized the old part and constructed the new one while utilizing the ESO software (Menuhin et al 2022). The ESO is a software constructed by TAU IGEM team 2020 as part of their project, and we used this software with their help and under their guidance. The software optimizes the evolutionary stability of a given DNA construct, by preventing sites that are prone to mutation and recombination while preserving the amino acid sequence. While designing this new part, the goal stood in front of our eyes was to induce minimal changes, so the functionality of the initial construct will be preserved, while the evolutionary stability of the construct greatly elevated. This was verified by a lab evolution experiment (please refer to the “improvement of an existing part” page for further details). The users of that part should address it exactly the same as they were addressing the original one – use it as an eCFP coding device with an IPTG inducible promoter – while taking into account that it is evolutionary-stabilized, namely will preserve its functionality for a longer period of time.

Design Considerations: The sequence of this part was determined by utilizing the ESO software, developed by 2020 TAU IGEM team. The software changes the DNA sequence in order to prevent sites that are prone to mutation or recombination while preserving the amino acid sequence. Our team created two variations of each part, one that only optimized the evolutionary stability of the construct, and a second one that also optimized the sequence for E.coli expression (codon usage optimization; for further information please refer to the “improvement of an existing part” page). Our team manually checked the work of the algorithm by MSA, to verify that indeed the amino acid sequence was preserved.

Sequence (of the fully-optimized version, including codon bias optimization):

GAATTCGCGGCCGCTTCTAGAGCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACATACTAGAGAAAGAGGAGAAATACTAGATGGTGTCGAAAGGTGAAGAGCTGTTTACCGGGGTCGTTCCGATCCTAGTCGAATTGGATGGAGATGTTAATGGTCACAAGTTTAGCGTGTCGGGTGAAGGTGAGGGCGATGCAACGTACGGCAAACTGACCTTAAAATTTATCTGCACGACTGGCAAGCTGCCAGTGCCATGGCCCACGCTCGTGACTACCCTTACATGGGGAGTTCAGTGTTTCAGTCGCTACCCGGATCACATGAAACAACATGACTTCTTCAAGTCCGCGATGCCTGAAGGTTACGTCCAAGAACGTACCATTTTTTTTAAAGATGACGGCAATTACAAAACCCGGGCCGAAGTGAAATTTGAAGGCGACACCCTGGTTAACCGCATTGAGCTGAAAGGTATAGATTTCAAAGAAGACGGCAACATCCTGGGGCATAAACTGGAATATAACTATATTTCACATAACGTCTATATCACGGCCGACAAACAGAAAAATGGTATTAAGGCGAACTTTAAGATTCGTCACAATATTGAGGATGGTAGCGTACAACTCGCGGATCATTACCAGCAGAACACACCGATCGGCGATGGCCCGGTGTTGTTACCGGACAATCACTATTTAAGCACGCAGTCCGCACTGTCTAAAGATCCGAACGAGAAACGCGATCATATGGTACTTCTGGAATTCGTTACCGCAGCGGGGATTACTTTGGGCATGGACGAACTGTATAAACGTCCTGCTGCAAACGATGAAAATTATGCGTTAGTAGCTTAATGATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAG

Length: 1168 base pairs.