How did we contribute to iGem?
Our contribution focuses on the Golden Gate cloning system used in this year’s iGEM competition. We faced some trouble in the blue/white screening process in the early stages of the project. We screened our transformed and plated colonies on XGAL and IPTG LB-Agar plates and picked white clones which apparently lacked the lacZ insert cassette. Despite this procedure, the rate of negative white clones (which lacked the desired insert and even sometimes still contained lacZ) in the subsequent colony PCR, diagnostic digest or sequencing was very high (above 70%).
Therefore, we decided to use basic level 0 parts from the distribution kit to manufacture level 1 acceptor plasmid backbones, which instead of lacZ contained the chromoprotein meffBlue, under a pTac promotor with a 6xHis-tag, a BCD2 RBS and ECK12009600 as a terminator. This meant that rather than 140 µL of 20 mg/mL XGAL and 40 µL of 100 mM IPTG, we could only use 100 µL of 5 mM IPTG (that induces the pTac promotor) to screen for white colonies, which was both more efficient and additionally saved resources. The pOdd chromobackbones as we call them can be seen under Biobrick Nr. BBa_K4285016 to BBa_K4285019.
To achieve this, we firstly combined the basic distribution parts (acceptor plasmid, promotor, RBS, tag, gene, and terminator) in a level 1 BsaI Golden Gate reaction with a pOdd vector (BsaI recognition sites are gone with the lacZ insert as usual) and screened the transformed constructs on LB-Agar with XGAL and IPTG for dark blue colonies (The shade of blue obtained from meffBlue is darker and more purple than the one obtained in a normal blue/white screening (see Figure 4)).
Figure 1: Sequence of the new insert cassette in pOdd shown in Benchling with promotor sequences for re-insertion into level 1, 2 and 3 backbones.
Then we performed a PCR with the isolated plasmid gathered from these clones as a template (Primer Sequences below), in which the primers bind to the ends of the inserted cassette and introduce the outward facing BsaI cut- and recognition sites similar to the one lacZ carries normally via overhang PCR (see Figure 2).
Primer sequences:
Fw: AGGAGTGAGACCAACGATCGTTGGCTGTGTTGACA
Rev: TAGCGTGAGACCTTGAGAAGAGAAAAGAAAACCGC
Figure 2: Extended insert cassette with new BsaI recognition site, ready for insertion into pOdd vectors
Then to create the final acceptor plasmid in the next round of the level 1 Golden Gate BsaI reaction, the elongated insert (with outward facing BsaI recognition sites) was incubated with a classic pOdd vector with lacZ. The restriction enzyme cuts both BsaI sites (one in the acceptor and the new one in the donor) and then after ligation leaves in the necessary outward facing BsaI recognition site of the insert to function in future level 1 assemblies, which was screened on LB-Agar only IPTG for dark blue colonies (see Figure 3).
Figure 3: Final pOdd1 chromobackbone with functioning BsaI recognition site.
Overall, this process is also repeatable in the same manner for level 2 and level 3 backbones (by using different promotors) and makes the screening process easier. The additional stress of expressing the chromoprotein results in slow growing dark blue colonies, which still feature the inserted meffBlue and fast-growing white colonies which contain the newly inserted cassette more often than possible in the blue/white screening.
Example pictures of screening with the chromobackbones:
Figure 4: Shows plates featuring the new chromo-screening with meffBlue on the left side (LB-Agar with 100 µL 5 mM IPTG) and the old blue/white screening on the right side (140 µL 20 mg/mL XGAL and 40 µL 100 mM IPTG). Both plates were incubated at 37°C after plating the transformed colonies and screened for white clones. The meffBlue expressing negative clones on the left are growing slower in contrast to their lacZ counterparts on the right, which also makes the screening process easier overall.